Incidental Mutation 'R5888:Scnm1'
ID 457775
Institutional Source Beutler Lab
Gene Symbol Scnm1
Ensembl Gene ENSMUSG00000092607
Gene Name sodium channel modifier 1
Synonyms 3110001I17Rik, Scnm1-ps
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 95037030-95041285 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95037596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 157 (I157V)
Ref Sequence ENSEMBL: ENSMUSP00000134337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000066386] [ENSMUST00000107227] [ENSMUST00000131597] [ENSMUST00000172572] [ENSMUST00000173462]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005769
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066386
SMART Domains Protein: ENSMUSP00000067811
Gene: ENSMUSG00000053769

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LysM 41 85 2.58e-7 SMART
low complexity region 100 108 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130545
Predicted Effect probably benign
Transcript: ENSMUST00000131597
SMART Domains Protein: ENSMUSP00000116341
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149898
Predicted Effect probably benign
Transcript: ENSMUST00000172572
AA Change: I157V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607
AA Change: I157V

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173462
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173527
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009]
PHENOTYPE: The Scnm1 locus influences the severity of the Scn8amed-J phenotype. Mice carrying the recesive susceptibility allele of the modifier are paralyzed and do not survive beyond 1 month. Mice carryimg the resistant allele display progressive dystonia with ataxia and live more than 1.5 years. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Asap2 T A 12: 21,268,191 (GRCm39) I319N probably damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Kpna7 A G 5: 144,926,605 (GRCm39) F449S probably damaging Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Lair1 A T 7: 4,013,844 (GRCm39) D134E probably damaging Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mdc1 T A 17: 36,158,712 (GRCm39) V364E probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Thsd7b T A 1: 130,138,057 (GRCm39) Y1578* probably null Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Tnk2 G A 16: 32,490,185 (GRCm39) V363I probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Scnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02964:Scnm1 APN 3 95,040,348 (GRCm39) missense probably benign 0.07
R1917:Scnm1 UTSW 3 95,037,584 (GRCm39) missense possibly damaging 0.59
R5538:Scnm1 UTSW 3 95,037,066 (GRCm39) utr 3 prime probably benign
R5955:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R5956:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R6082:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R6086:Scnm1 UTSW 3 95,037,596 (GRCm39) missense probably benign 0.06
R7182:Scnm1 UTSW 3 95,041,165 (GRCm39) missense possibly damaging 0.60
R7206:Scnm1 UTSW 3 95,041,205 (GRCm39) start codon destroyed probably null 1.00
R7605:Scnm1 UTSW 3 95,040,186 (GRCm39) missense probably benign 0.03
R8517:Scnm1 UTSW 3 95,040,134 (GRCm39) critical splice donor site probably null
Z1176:Scnm1 UTSW 3 95,037,652 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGTGTGCCCCTATAAAG -3'
(R):5'- AAATCAGTTTCAAGCGCTGCTC -3'

Sequencing Primer
(F):5'- GTCTGAAAACAGGCAGGTCCC -3'
(R):5'- AAGCGCTGCTCTTCTGG -3'
Posted On 2017-02-15