Incidental Mutation 'R5888:Eif2ak1'
ID457789
Institutional Source Beutler Lab
Gene Symbol Eif2ak1
Ensembl Gene ENSMUSG00000029613
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 1
SynonymsHri
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5888 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143817788-143904251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143886915 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 393 (I393M)
Ref Sequence ENSEMBL: ENSMUSP00000098056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079624] [ENSMUST00000100487] [ENSMUST00000110717] [ENSMUST00000110718]
Predicted Effect probably benign
Transcript: ENSMUST00000079624
SMART Domains Protein: ENSMUSP00000078571
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 36 61 2.55e2 SMART
ANK 65 118 8.5e2 SMART
ANK 124 153 1.27e-2 SMART
ANK 157 186 7.95e-4 SMART
ANK 191 230 3.74e0 SMART
ANK 234 263 3.46e-4 SMART
Blast:ANK 267 300 4e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000100487
AA Change: I393M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098056
Gene: ENSMUSG00000029613
AA Change: I393M

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Pfam:Pkinase_Tyr 167 242 5.6e-6 PFAM
Pfam:Pkinase 167 257 1.9e-15 PFAM
low complexity region 314 320 N/A INTRINSIC
Pfam:Pkinase 365 580 1.3e-31 PFAM
Pfam:Pkinase_Tyr 373 578 1.9e-19 PFAM
coiled coil region 585 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110717
SMART Domains Protein: ENSMUSP00000106345
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
Blast:ANK 28 57 6e-11 BLAST
ANK 78 103 1.6e0 SMART
ANK 107 160 5.6e0 SMART
ANK 166 195 8.4e-5 SMART
ANK 199 228 5.3e-6 SMART
ANK 233 272 2.4e-2 SMART
ANK 276 305 2.3e-6 SMART
Blast:ANK 309 342 5e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110718
SMART Domains Protein: ENSMUSP00000106346
Gene: ENSMUSG00000029607

DomainStartEndE-ValueType
ANK 35 60 2.55e2 SMART
ANK 64 117 8.5e2 SMART
ANK 123 152 1.27e-2 SMART
ANK 156 185 7.95e-4 SMART
ANK 190 229 3.74e0 SMART
ANK 233 262 3.46e-4 SMART
Blast:ANK 266 299 4e-11 BLAST
Meta Mutation Damage Score 0.2386 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts at the level of translation initiation to downregulate protein synthesis in response to stress. The encoded protein is a kinase that can be inactivated by hemin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit enlarged heart size and abnormal red blood cell development, morphology, and physiology with macrocytic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Eif2ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Eif2ak1 APN 5 143889470 missense probably damaging 0.99
IGL02170:Eif2ak1 APN 5 143879460 missense probably benign 0.01
IGL02472:Eif2ak1 APN 5 143884883 missense probably benign 0.00
IGL02898:Eif2ak1 APN 5 143889452 missense probably damaging 1.00
IGL03078:Eif2ak1 APN 5 143873769 missense probably benign 0.02
PIT4520001:Eif2ak1 UTSW 5 143899209 nonsense probably null
R0523:Eif2ak1 UTSW 5 143882166 missense probably damaging 1.00
R0755:Eif2ak1 UTSW 5 143884924 missense possibly damaging 0.94
R1128:Eif2ak1 UTSW 5 143899176 unclassified probably null
R1203:Eif2ak1 UTSW 5 143883979 missense probably benign 0.00
R1445:Eif2ak1 UTSW 5 143873899 splice site probably benign
R1474:Eif2ak1 UTSW 5 143871967 missense probably damaging 1.00
R1972:Eif2ak1 UTSW 5 143884714 missense probably benign 0.04
R3885:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R3889:Eif2ak1 UTSW 5 143884661 missense probably benign 0.21
R4754:Eif2ak1 UTSW 5 143901803 missense probably damaging 0.99
R4971:Eif2ak1 UTSW 5 143882168 missense probably damaging 1.00
R5007:Eif2ak1 UTSW 5 143873880 missense probably benign
R5487:Eif2ak1 UTSW 5 143897163 critical splice acceptor site probably null
R5505:Eif2ak1 UTSW 5 143817990 missense probably benign
R5808:Eif2ak1 UTSW 5 143883994 missense probably benign 0.21
R6290:Eif2ak1 UTSW 5 143884799 missense probably benign 0.34
R6322:Eif2ak1 UTSW 5 143899095 missense probably benign 0.05
R6475:Eif2ak1 UTSW 5 143818010 unclassified probably null
R7343:Eif2ak1 UTSW 5 143877671 missense probably damaging 1.00
R7525:Eif2ak1 UTSW 5 143886898 missense probably damaging 1.00
R7554:Eif2ak1 UTSW 5 143879478 missense probably damaging 1.00
R7659:Eif2ak1 UTSW 5 143889462 missense probably damaging 1.00
X0027:Eif2ak1 UTSW 5 143879435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCAGTTAGTCATGGTGTC -3'
(R):5'- TGCAGATGAGCACATACCCAC -3'

Sequencing Primer
(F):5'- AGCAGTTAGTCATGGTGTCTGACC -3'
(R):5'- CTAGGTGACTCTAGATCCTGTCAAG -3'
Posted On2017-02-15