Incidental Mutation 'R5888:Kpna7'
ID 457790
Institutional Source Beutler Lab
Gene Symbol Kpna7
Ensembl Gene ENSMUSG00000038770
Gene Name karyopherin subunit alpha 7
Synonyms LOC381686, importin alpha 2
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.322) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 144920537-144946446 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144926605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 449 (F449S)
Ref Sequence ENSEMBL: ENSMUSP00000112155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110672] [ENSMUST00000110673] [ENSMUST00000116454]
AlphaFold C0LLJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000110672
AA Change: F449S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106300
Gene: ENSMUSG00000038770
AA Change: F449S

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110673
AA Change: F470S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106301
Gene: ENSMUSG00000038770
AA Change: F470S

DomainStartEndE-ValueType
Pfam:IBB 6 90 2.7e-19 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 3.31e-10 SMART
ARM 206 247 1.78e-1 SMART
ARM 250 289 4.28e-4 SMART
ARM 291 331 1.19e-2 SMART
ARM 333 373 5.27e-4 SMART
ARM 375 414 2.85e0 SMART
ARM 417 457 8.17e-1 SMART
Pfam:Arm_3 466 517 8.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116454
AA Change: F449S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112155
Gene: ENSMUSG00000038770
AA Change: F449S

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142866
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import, but exhibits different nuclear localization signal binding specificity compared to other members of the family. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display smaller litter sizes with preferential loss of females and accelerated cell cycles post fertilization resulting in loss of embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Asap2 T A 12: 21,268,191 (GRCm39) I319N probably damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Lair1 A T 7: 4,013,844 (GRCm39) D134E probably damaging Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mdc1 T A 17: 36,158,712 (GRCm39) V364E probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Thsd7b T A 1: 130,138,057 (GRCm39) Y1578* probably null Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Tnk2 G A 16: 32,490,185 (GRCm39) V363I probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Kpna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Kpna7 APN 5 144,944,056 (GRCm39) missense probably damaging 1.00
IGL01505:Kpna7 APN 5 144,929,661 (GRCm39) missense probably damaging 1.00
IGL02009:Kpna7 APN 5 144,930,888 (GRCm39) critical splice acceptor site probably null
IGL02365:Kpna7 APN 5 144,922,543 (GRCm39) missense possibly damaging 0.49
IGL02947:Kpna7 APN 5 144,930,884 (GRCm39) missense probably damaging 1.00
IGL03195:Kpna7 APN 5 144,933,847 (GRCm39) missense probably damaging 1.00
IGL03236:Kpna7 APN 5 144,922,504 (GRCm39) missense unknown
IGL03333:Kpna7 APN 5 144,942,765 (GRCm39) missense possibly damaging 0.48
PIT4515001:Kpna7 UTSW 5 144,941,862 (GRCm39) missense probably benign 0.17
R0027:Kpna7 UTSW 5 144,926,507 (GRCm39) missense probably damaging 0.99
R0421:Kpna7 UTSW 5 144,926,551 (GRCm39) missense possibly damaging 0.82
R0463:Kpna7 UTSW 5 144,944,804 (GRCm39) missense possibly damaging 0.66
R2229:Kpna7 UTSW 5 144,926,507 (GRCm39) missense probably damaging 0.99
R2871:Kpna7 UTSW 5 144,930,745 (GRCm39) missense probably benign 0.06
R2871:Kpna7 UTSW 5 144,930,745 (GRCm39) missense probably benign 0.06
R2873:Kpna7 UTSW 5 144,930,745 (GRCm39) missense probably benign 0.06
R2874:Kpna7 UTSW 5 144,930,745 (GRCm39) missense probably benign 0.06
R4079:Kpna7 UTSW 5 144,942,737 (GRCm39) missense possibly damaging 0.82
R5841:Kpna7 UTSW 5 144,930,766 (GRCm39) missense possibly damaging 0.73
R6188:Kpna7 UTSW 5 144,929,654 (GRCm39) missense probably damaging 1.00
R7163:Kpna7 UTSW 5 144,939,206 (GRCm39) missense unknown
R7502:Kpna7 UTSW 5 144,942,731 (GRCm39) missense probably benign 0.07
R7727:Kpna7 UTSW 5 144,941,855 (GRCm39) missense probably benign 0.19
R8921:Kpna7 UTSW 5 144,941,840 (GRCm39) missense probably damaging 1.00
R9672:Kpna7 UTSW 5 144,944,776 (GRCm39) missense probably benign 0.31
X0021:Kpna7 UTSW 5 144,944,043 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACAAGCTTCCTGATACTCAAAGG -3'
(R):5'- AGCTGAAGTTCCACGTGCAC -3'

Sequencing Primer
(F):5'- TGATACTCAAAGGCCACCTGTAG -3'
(R):5'- TGGGTCTCACTGTCTCTTTGCTGGCT -3'
Posted On 2017-02-15