Incidental Mutation 'R5888:Spock3'
ID 457801
Institutional Source Beutler Lab
Gene Symbol Spock3
Ensembl Gene ENSMUSG00000054162
Gene Name sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms testican 3, 2900045C01Rik
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 62951009-63357103 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63355300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 410 (N410K)
Ref Sequence ENSEMBL: ENSMUSP00000112930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093480] [ENSMUST00000117377] [ENSMUST00000118003] [ENSMUST00000119068]
AlphaFold Q8BKV0
Predicted Effect unknown
Transcript: ENSMUST00000093480
AA Change: N410K
SMART Domains Protein: ENSMUSP00000091192
Gene: ENSMUSG00000054162
AA Change: N410K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000117377
AA Change: N407K
SMART Domains Protein: ENSMUSP00000113797
Gene: ENSMUSG00000054162
AA Change: N407K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 135 180 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 195 305 5e-35 PFAM
TY 335 381 2.27e-17 SMART
low complexity region 400 431 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118003
AA Change: N410K
SMART Domains Protein: ENSMUSP00000113683
Gene: ENSMUSG00000054162
AA Change: N410K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 1.1e-36 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119068
AA Change: N410K
SMART Domains Protein: ENSMUSP00000112930
Gene: ENSMUSG00000054162
AA Change: N410K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious morphological or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Spock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Spock3 APN 8 63348959 missense probably benign 0.01
IGL01716:Spock3 APN 8 63355350 missense unknown
IGL02058:Spock3 APN 8 63245198 nonsense probably null
IGL02450:Spock3 APN 8 63245215 critical splice donor site probably null
IGL02610:Spock3 APN 8 63345737 missense probably damaging 1.00
IGL03046:Spock3 UTSW 8 63348984 critical splice donor site probably null
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0084:Spock3 UTSW 8 63143929 missense probably damaging 1.00
R1422:Spock3 UTSW 8 63143989 missense possibly damaging 0.89
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1484:Spock3 UTSW 8 63220705 missense probably damaging 1.00
R1728:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1729:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1739:Spock3 UTSW 8 63348947 missense probably damaging 0.99
R2057:Spock3 UTSW 8 63245170 nonsense probably null
R2340:Spock3 UTSW 8 63345713 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3733:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3763:Spock3 UTSW 8 63144015 critical splice donor site probably null
R5000:Spock3 UTSW 8 63245124 missense possibly damaging 0.86
R5069:Spock3 UTSW 8 63355265 missense probably benign 0.01
R5076:Spock3 UTSW 8 63345855 missense probably damaging 1.00
R5232:Spock3 UTSW 8 63345809 missense probably damaging 1.00
R5329:Spock3 UTSW 8 63345782 missense probably damaging 1.00
R5621:Spock3 UTSW 8 63144006 missense probably benign 0.19
R5882:Spock3 UTSW 8 63143931 missense probably benign 0.03
R5902:Spock3 UTSW 8 63355302 missense unknown
R6991:Spock3 UTSW 8 63355381 makesense probably null
R7317:Spock3 UTSW 8 63113556 missense possibly damaging 0.52
R7970:Spock3 UTSW 8 63345715 missense probably damaging 1.00
R8030:Spock3 UTSW 8 63352198 missense probably damaging 1.00
R8392:Spock3 UTSW 8 63355311 missense unknown
R8889:Spock3 UTSW 8 62951952 nonsense probably null
R8892:Spock3 UTSW 8 62951952 nonsense probably null
R9065:Spock3 UTSW 8 63348955 missense probably damaging 0.98
R9199:Spock3 UTSW 8 63345730 missense probably damaging 1.00
R9377:Spock3 UTSW 8 63345712 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGTGAGAGTTTTAGCTGAGAAC -3'
(R):5'- GAACCACTTTGTTTAGGGATAAGAAGG -3'

Sequencing Primer
(F):5'- GAGTTTTAGCTGAGAACAAACTTCCC -3'
(R):5'- ATCATGGACATCCCCATC -3'
Posted On 2017-02-15