Incidental Mutation 'R5888:March10'
ID 457820
Institutional Source Beutler Lab
Gene Symbol March10
Ensembl Gene ENSMUSG00000078627
Gene Name membrane-associated ring finger (C3HC4) 10
Synonyms 4933417C16Rik, OTTMUSG00000002847, Rnf190
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 105360798-105456735 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105402146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 145 (V145D)
Ref Sequence ENSEMBL: ENSMUSP00000097906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049995] [ENSMUST00000100332] [ENSMUST00000138977]
AlphaFold E9PX79
Predicted Effect probably benign
Transcript: ENSMUST00000049995
SMART Domains Protein: ENSMUSP00000063198
Gene: ENSMUSG00000078627

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100332
AA Change: V145D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097906
Gene: ENSMUSG00000078627
AA Change: V145D

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
low complexity region 161 168 N/A INTRINSIC
low complexity region 181 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138977
SMART Domains Protein: ENSMUSP00000121919
Gene: ENSMUSG00000078627

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151305
AA Change: V40D
SMART Domains Protein: ENSMUSP00000118401
Gene: ENSMUSG00000078627
AA Change: V40D

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
low complexity region 77 102 N/A INTRINSIC
Meta Mutation Damage Score 0.0837 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH10 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in March10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:March10 APN 11 105402188 missense possibly damaging 0.82
IGL01461:March10 APN 11 105389605 missense probably damaging 1.00
IGL01473:March10 APN 11 105389605 missense probably damaging 1.00
Forward UTSW 11 105382237 missense probably damaging 1.00
PIT4142001:March10 UTSW 11 105390520 missense probably benign 0.17
R0195:March10 UTSW 11 105385525 missense probably damaging 1.00
R0520:March10 UTSW 11 105389882 missense probably benign
R0628:March10 UTSW 11 105390160 missense probably benign 0.00
R1087:March10 UTSW 11 105390662 missense probably damaging 1.00
R1440:March10 UTSW 11 105390583 missense probably damaging 1.00
R1802:March10 UTSW 11 105389915 missense probably benign 0.00
R1855:March10 UTSW 11 105390392 missense probably benign
R1860:March10 UTSW 11 105397078 missense probably damaging 0.99
R2504:March10 UTSW 11 105385572 missense probably damaging 1.00
R3788:March10 UTSW 11 105397079 missense probably damaging 1.00
R4629:March10 UTSW 11 105389838 missense probably benign 0.28
R4755:March10 UTSW 11 105364476 intron probably benign
R4776:March10 UTSW 11 105390037 missense probably benign 0.42
R5067:March10 UTSW 11 105390107 missense possibly damaging 0.51
R5192:March10 UTSW 11 105371926 missense possibly damaging 0.68
R5436:March10 UTSW 11 105402165 missense possibly damaging 0.92
R5541:March10 UTSW 11 105390131 missense probably damaging 1.00
R5908:March10 UTSW 11 105390239 missense probably benign 0.00
R5914:March10 UTSW 11 105385482 missense probably damaging 1.00
R6038:March10 UTSW 11 105402051 missense probably damaging 0.96
R6178:March10 UTSW 11 105389614 missense probably damaging 1.00
R6300:March10 UTSW 11 105382237 missense probably damaging 1.00
R6612:March10 UTSW 11 105397078 missense probably damaging 0.99
R6894:March10 UTSW 11 105396961 missense possibly damaging 0.94
R6921:March10 UTSW 11 105389777 missense probably benign 0.00
R7134:March10 UTSW 11 105408676 missense probably benign
R7199:March10 UTSW 11 105390706 missense probably damaging 0.99
R7546:March10 UTSW 11 105390080 missense not run
R7792:March10 UTSW 11 105390228 missense probably benign
R8241:March10 UTSW 11 105389915 missense probably benign 0.00
R8467:March10 UTSW 11 105390153 nonsense probably null
R8843:March10 UTSW 11 105401976 missense possibly damaging 0.83
R8962:March10 UTSW 11 105389989 nonsense probably null
R9214:March10 UTSW 11 105390274 missense probably benign 0.02
R9323:March10 UTSW 11 105389755 missense probably damaging 0.98
Z1088:March10 UTSW 11 105390359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTTTACTGGGCCTTCTGGG -3'
(R):5'- TCAGACCTGAGCAAGATGCC -3'

Sequencing Primer
(F):5'- TAGACACAGCACAGGGGTCTC -3'
(R):5'- GTGAATGCTGCTTCCTGA -3'
Posted On 2017-02-15