Mutagenetix > Incidental Mutation

Incidental Mutation 'R5888:Nrxn3'

457823

Institutional Source

Beutler Lab

Gene Symbol

Nrxn3

Ensembl Gene

ENSMUSG00000066392

Gene Name

neurexin III

Synonyms

4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta

MMRRC Submission

044089-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5888 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88722876-90334935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 89512085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 983 (A983S)

Ref Sequence

ENSEMBL: ENSMUSP00000129678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]

AlphaFold

Q6P9K9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057634
AA Change: A610S

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: A610S

Domain	Start	End	E-Value	Type
LamG	94	246	3.28e-41	SMART
EGF	273	307	4.1e-2	SMART
LamG	332	470	4.87e-26	SMART
LamG	518	654	7.08e-37	SMART
EGF	688	722	1.99e1	SMART
LamG	750	907	1.14e-17	SMART
low complexity region	948	964	N/A	INTRINSIC
low complexity region	1028	1043	N/A	INTRINSIC
4.1m	1046	1064	4.38e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163134
AA Change: A983S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: A983S

Domain	Start	End	E-Value	Type
LamG	47	184	9.8e-31	SMART
EGF	201	235	8.07e-1	SMART
LamG	279	413	7.19e-38	SMART
LamG	467	619	3.28e-41	SMART
EGF	646	680	4.1e-2	SMART
LamG	705	843	4.87e-26	SMART
LamG	891	1027	7.08e-37	SMART
EGF	1052	1086	1.99e1	SMART
LamG	1114	1271	1.14e-17	SMART
low complexity region	1312	1328	N/A	INTRINSIC
low complexity region	1395	1406	N/A	INTRINSIC
low complexity region	1499	1514	N/A	INTRINSIC
4.1m	1517	1535	4.38e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167103
AA Change: A974S

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: A974S

Domain	Start	End	E-Value	Type
LamG	47	184	9.8e-31	SMART
EGF	201	235	8.07e-1	SMART
LamG	279	413	7.19e-38	SMART
LamG	467	619	3.28e-41	SMART
EGF	646	680	4.1e-2	SMART
LamG	705	834	5.76e-28	SMART
LamG	882	1018	7.08e-37	SMART
EGF	1043	1077	1.99e1	SMART
LamG	1105	1262	1.14e-17	SMART
low complexity region	1303	1319	N/A	INTRINSIC
low complexity region	1354	1382	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167887
AA Change: A610S

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: A610S

Domain	Start	End	E-Value	Type
LamG	94	246	3.28e-41	SMART
EGF	273	307	4.1e-2	SMART
LamG	332	470	4.87e-26	SMART
LamG	518	654	7.08e-37	SMART
EGF	688	722	1.99e1	SMART
LamG	750	907	1.14e-17	SMART
low complexity region	948	964	N/A	INTRINSIC
low complexity region	1028	1043	N/A	INTRINSIC
4.1m	1046	1064	4.38e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190626
AA Change: A610S

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: A610S

Domain	Start	End	E-Value	Type
LamG	94	246	2.1e-43	SMART
EGF	273	307	2e-4	SMART
LamG	332	470	3.1e-28	SMART
LamG	518	654	4.4e-39	SMART
EGF	688	722	9.6e-2	SMART
LamG	750	877	1.1e-22	SMART
low complexity region	918	934	N/A	INTRINSIC
low complexity region	972	1000	N/A	INTRINSIC

Meta Mutation Damage Score

0.1631

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

94% (96/102)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029P11Rik	T	C	15: 81,980,671	S38P	probably benign	Het
Adcy1	T	A	11: 7,139,095	V503E	possibly damaging	Het
Alk	C	A	17: 71,874,943	V1362L	probably damaging	Het
Ankrd55	T	A	13: 112,355,919	I208N	possibly damaging	Het
Asap2	T	A	12: 21,218,190	I319N	probably damaging	Het
Atp11b	T	C	3: 35,837,547	I1036T	probably benign	Het
B4gat1	T	C	19: 5,039,532	F186L	probably benign	Het
C3	T	A	17: 57,214,831	T1079S	probably damaging	Het
Cacul1	G	T	19: 60,537,464	T287K	possibly damaging	Het
Cbr3	G	C	16: 93,690,726	G266R	probably damaging	Het
Cd63	T	A	10: 128,912,291		probably null	Het
Chd7	G	A	4: 8,866,382	M851I	probably damaging	Het
Chst13	T	A	6: 90,309,572	H136L	probably benign	Het
Cyp2d22	T	C	15: 82,373,813	T179A	probably benign	Het
Dclre1b	A	T	3: 103,803,737	V286E	probably damaging	Het
Defb45	G	A	2: 152,593,234		probably benign	Het
Dlg1	T	C	16: 31,791,886		probably null	Het
Dock3	A	G	9: 107,023,803	V321A	probably benign	Het
Dytn	A	T	1: 63,677,237	V59E	possibly damaging	Het
Eif2ak1	A	G	5: 143,886,915	I393M	probably damaging	Het
Fam83g	A	T	11: 61,702,594	E318V	probably benign	Het
Fbxo34	T	A	14: 47,529,719	F179I	probably damaging	Het
Fmo5	T	A	3: 97,641,725	Y230N	probably benign	Het
Fzd9	T	G	5: 135,249,463		probably null	Het
Gata2	T	C	6: 88,200,740	S251P	probably benign	Het
Gigyf1	A	G	5: 137,525,697	D1043G	probably damaging	Het
Gm10260	G	A	13: 97,760,393	R66*	probably null	Het
Gm10322	T	A	10: 59,616,303	S81T	probably benign	Het
Gm11639	T	C	11: 104,721,401		probably benign	Het
Gm15517	A	T	7: 44,260,642		probably benign	Het
Haus4	T	C	14: 54,544,219	T232A	probably benign	Het
Hgfac	A	T	5: 35,045,407	H417L	probably damaging	Het
Iqgap2	T	C	13: 95,635,610	K1354E	possibly damaging	Het
Kcnk12	C	A	17: 87,746,649	R195L	probably benign	Het
Kcnn2	A	T	18: 45,592,345	I303F	probably damaging	Het
Kcnt1	T	C	2: 25,908,110	F879S	probably damaging	Het
Kndc1	T	C	7: 139,895,217	F11L	probably benign	Het
Kpna7	A	G	5: 144,989,795	F449S	probably damaging	Het
Krt77	G	T	15: 101,865,453	N255K	probably benign	Het
Lair1	A	T	7: 4,010,845	D134E	probably damaging	Het
Loxhd1	T	C	18: 77,402,515	V1318A	probably damaging	Het
March10	A	T	11: 105,402,146	V145D	possibly damaging	Het
Mcpt1	T	A	14: 56,019,512	M169K	probably benign	Het
Mdc1	T	A	17: 35,847,820	V364E	probably benign	Het
Mfsd11	T	C	11: 116,871,384	F270S	probably damaging	Het
Mfsd4b2	T	G	10: 39,922,035	D108A	probably benign	Het
Mink1	A	T	11: 70,610,059		probably benign	Het
Mmp25	T	C	17: 23,631,074	Y504C	probably damaging	Het
Ms4a13	C	T	19: 11,191,506	V52I	probably benign	Het
Msh4	C	T	3: 153,867,723		probably null	Het
Muc5b	T	G	7: 141,858,421	S1701R	unknown	Het
Naalad2	A	T	9: 18,330,641	S656T	probably benign	Het
Ncapd2	T	C	6: 125,187,089	Y64C	probably damaging	Het
Ncapg2	T	A	12: 116,425,800	S347T	possibly damaging	Het
Nipal4	T	C	11: 46,151,339	T172A	probably damaging	Het
Nrros	T	C	16: 32,143,087	K652R	probably benign	Het
Olfr1084	A	C	2: 86,639,144	L188R	probably damaging	Het
Olfr1187-ps1	T	C	2: 88,540,244		noncoding transcript	Het
Olfr1220	T	A	2: 89,097,925	M1L	probably damaging	Het
Olfr1249	T	A	2: 89,630,799	Y33F	probably damaging	Het
Olfr1283	T	C	2: 111,368,743	M37T	probably benign	Het
Olfr631	A	G	7: 103,929,032	T70A	possibly damaging	Het
Olfr938	A	T	9: 39,077,967	Y259*	probably null	Het
P2rx4	T	A	5: 122,719,165	S155T	probably benign	Het
P2rx4	T	G	5: 122,727,208	Y299D	probably damaging	Het
Pcsk6	A	T	7: 66,043,624	L7F	probably null	Het
Pdss2	T	C	10: 43,221,797		silent	Het
Pfkl	A	G	10: 77,991,370	V494A	possibly damaging	Het
Prep	G	T	10: 45,067,364	D12Y	possibly damaging	Het
Prg4	A	G	1: 150,452,350	F188S	probably damaging	Het
Ripor3	T	C	2: 167,997,287	Y98C	probably damaging	Het
Rnf216	T	A	5: 143,068,314		probably null	Het
Rnf24	A	G	2: 131,322,245		probably benign	Het
Scn3a	A	G	2: 65,497,398	M916T	probably benign	Het
Scnm1	T	C	3: 95,130,285	I157V	probably benign	Het
Sh2b3	C	G	5: 121,829,021	R10P	possibly damaging	Het
Slc25a27	T	C	17: 43,649,694	D211G	probably damaging	Het
Slc36a4	A	T	9: 15,727,028	Y250F	probably damaging	Het
Slc4a1	T	A	11: 102,356,525	E448V	probably damaging	Het
Slit1	C	A	19: 41,743,296	C38F	probably damaging	Het
Spock3	T	A	8: 63,355,300	N410K	unknown	Het
Supt20	G	T	3: 54,712,207	W370L	probably benign	Het
Tas2r139	T	A	6: 42,141,496	N187K	probably damaging	Het
Tbc1d9b	G	A	11: 50,140,484	V111I	probably benign	Het
Thsd7b	T	A	1: 130,210,320	Y1578*	probably null	Het
Tln2	T	A	9: 67,229,403	I1267F	probably damaging	Het
Tnk2	G	A	16: 32,671,367	V363I	probably damaging	Het
Ttc32	A	G	12: 9,035,870	K139R	possibly damaging	Het
Vmn1r30	G	C	6: 58,435,565	T94S	possibly damaging	Het
Vmn1r90	G	A	7: 14,561,855	T106I	probably damaging	Het
Zfp677	T	A	17: 21,398,258	C526S	probably damaging	Het
Zfp831	T	G	2: 174,643,627	S32A	probably benign	Het

Other mutations in Nrxn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrxn3	APN	12	90204592	missense	probably damaging	1.00
IGL00961:Nrxn3	APN	12	90204546	missense	possibly damaging	0.95
IGL01073:Nrxn3	APN	12	89254740	missense	probably benign	0.25
IGL01338:Nrxn3	APN	12	89255034	missense	possibly damaging	0.86
IGL01377:Nrxn3	APN	12	89533012	critical splice donor site	probably null
IGL01409:Nrxn3	APN	12	89510358	missense	probably damaging	1.00
IGL01764:Nrxn3	APN	12	90204750	missense	possibly damaging	0.48
IGL02063:Nrxn3	APN	12	88795795	missense	possibly damaging	0.86
IGL02171:Nrxn3	APN	12	89193163	missense	probably damaging	1.00
IGL02309:Nrxn3	APN	12	89976407	missense	probably damaging	0.99
IGL02340:Nrxn3	APN	12	90204628	missense	possibly damaging	0.82
IGL02343:Nrxn3	APN	12	88795353	missense	probably damaging	1.00
IGL02600:Nrxn3	APN	12	89511912	splice site	probably benign
IGL02735:Nrxn3	APN	12	89254854	missense	probably benign	0.16
IGL03061:Nrxn3	APN	12	89511928	nonsense	probably null
IGL03206:Nrxn3	APN	12	89260508	missense	possibly damaging	0.88
IGL03337:Nrxn3	APN	12	89255020	missense	probably damaging	1.00
R0098:Nrxn3	UTSW	12	89260201	missense	probably damaging	1.00
R0098:Nrxn3	UTSW	12	89260201	missense	probably damaging	1.00
R0144:Nrxn3	UTSW	12	89348392	missense	probably damaging	1.00
R0334:Nrxn3	UTSW	12	89813642	critical splice donor site	probably null
R0531:Nrxn3	UTSW	12	88795342	missense	probably damaging	1.00
R0840:Nrxn3	UTSW	12	90331793	missense	possibly damaging	0.68
R1324:Nrxn3	UTSW	12	89254696	missense	possibly damaging	0.89
R1438:Nrxn3	UTSW	12	90332135	missense	probably damaging	1.00
R1484:Nrxn3	UTSW	12	89254777	missense	probably damaging	0.99
R1621:Nrxn3	UTSW	12	88795710	missense	probably benign
R1637:Nrxn3	UTSW	12	89354468	missense	possibly damaging	0.94
R1659:Nrxn3	UTSW	12	90332391	missense	probably damaging	1.00
R1746:Nrxn3	UTSW	12	89255019	missense	possibly damaging	0.63
R1801:Nrxn3	UTSW	12	90283582	missense	probably damaging	1.00
R1912:Nrxn3	UTSW	12	88795342	missense	probably damaging	1.00
R1940:Nrxn3	UTSW	12	89260381	missense	probably damaging	0.98
R1993:Nrxn3	UTSW	12	89260411	missense	possibly damaging	0.59
R2002:Nrxn3	UTSW	12	90332315	missense	probably damaging	1.00
R2125:Nrxn3	UTSW	12	89260520	splice site	probably null
R2179:Nrxn3	UTSW	12	89254678	missense	probably damaging	1.00
R2207:Nrxn3	UTSW	12	89348312	missense	probably damaging	1.00
R2284:Nrxn3	UTSW	12	89510365	missense	probably damaging	1.00
R2433:Nrxn3	UTSW	12	89976392	missense	probably damaging	1.00
R2969:Nrxn3	UTSW	12	89354471	missense	probably damaging	1.00
R3053:Nrxn3	UTSW	12	89255101	missense	probably damaging	0.99
R3076:Nrxn3	UTSW	12	89260416	missense	probably damaging	1.00
R3078:Nrxn3	UTSW	12	89260416	missense	probably damaging	1.00
R4033:Nrxn3	UTSW	12	89533001	missense	probably damaging	1.00
R4222:Nrxn3	UTSW	12	89532992	nonsense	probably null
R4321:Nrxn3	UTSW	12	90199231	missense	probably damaging	1.00
R4470:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4471:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4472:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4686:Nrxn3	UTSW	12	89510651	missense	probably damaging	0.99
R4776:Nrxn3	UTSW	12	90331956	missense	possibly damaging	0.55
R4821:Nrxn3	UTSW	12	90204709	missense	probably damaging	0.99
R4869:Nrxn3	UTSW	12	88795582	missense	possibly damaging	0.95
R4910:Nrxn3	UTSW	12	89260360	missense	possibly damaging	0.72
R4960:Nrxn3	UTSW	12	88795201	missense	possibly damaging	0.79
R4990:Nrxn3	UTSW	12	89260474	missense	probably damaging	1.00
R4991:Nrxn3	UTSW	12	89260474	missense	probably damaging	1.00
R5057:Nrxn3	UTSW	12	89255034	missense	probably damaging	0.99
R5329:Nrxn3	UTSW	12	89813584	missense	possibly damaging	0.92
R6249:Nrxn3	UTSW	12	89254678	missense	probably damaging	1.00
R6264:Nrxn3	UTSW	12	90332237	missense	probably damaging	1.00
R6373:Nrxn3	UTSW	12	89976469	missense	probably damaging	1.00
R6401:Nrxn3	UTSW	12	89255000	missense	possibly damaging	0.46
R6434:Nrxn3	UTSW	12	88795515	missense	probably benign	0.32
R6528:Nrxn3	UTSW	12	89513049	missense	probably damaging	1.00
R6612:Nrxn3	UTSW	12	89813332	intron	probably benign
R6632:Nrxn3	UTSW	12	89193154	missense	probably damaging	1.00
R6874:Nrxn3	UTSW	12	90332190	missense	probably damaging	0.99
R7122:Nrxn3	UTSW	12	89510607	missense	probably damaging	1.00
R7328:Nrxn3	UTSW	12	88795575	missense	probably benign
R7352:Nrxn3	UTSW	12	88850293	missense	probably benign
R7425:Nrxn3	UTSW	12	89513100	nonsense	probably null
R7444:Nrxn3	UTSW	12	89510694	missense	probably damaging	1.00
R7483:Nrxn3	UTSW	12	89510462	missense	probably damaging	1.00
R7599:Nrxn3	UTSW	12	89512062	missense	probably benign
R7738:Nrxn3	UTSW	12	88850304	missense	possibly damaging	0.68
R7765:Nrxn3	UTSW	12	89813484	missense	probably benign	0.03
R8139:Nrxn3	UTSW	12	90204664	missense	probably benign	0.01
R8192:Nrxn3	UTSW	12	90204795	missense	probably benign	0.08
R8351:Nrxn3	UTSW	12	89510643	missense	probably damaging	1.00
R8368:Nrxn3	UTSW	12	90332041	nonsense	probably null
R8397:Nrxn3	UTSW	12	90331809	missense	probably benign	0.17
R8426:Nrxn3	UTSW	12	88795327	missense	possibly damaging	0.91
R8451:Nrxn3	UTSW	12	89510643	missense	probably damaging	1.00
R8777:Nrxn3	UTSW	12	89260464	missense	probably damaging	1.00
R8777-TAIL:Nrxn3	UTSW	12	89260464	missense	probably damaging	1.00
R8844:Nrxn3	UTSW	12	89187150	missense	possibly damaging	0.88
R8870:Nrxn3	UTSW	12	90204786	missense	probably benign	0.00
R9043:Nrxn3	UTSW	12	89260482	missense	probably damaging	1.00
R9102:Nrxn3	UTSW	12	90332150	missense	probably benign	0.01
R9167:Nrxn3	UTSW	12	89187298	missense	probably damaging	1.00
R9445:Nrxn3	UTSW	12	89532967	nonsense	probably null
R9447:Nrxn3	UTSW	12	89254908	missense	probably benign	0.35
X0019:Nrxn3	UTSW	12	90199221	missense	probably damaging	1.00
Z1176:Nrxn3	UTSW	12	89187055	nonsense	probably null
Z1176:Nrxn3	UTSW	12	89517909	missense	possibly damaging	0.45
Z1177:Nrxn3	UTSW	12	88795688	missense	probably benign	0.00
Z1177:Nrxn3	UTSW	12	89260312	missense	probably damaging	1.00
Z1177:Nrxn3	UTSW	12	90331845	missense	probably benign	0.05
Z1177:Nrxn3	UTSW	12	90332114	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TACTTCATGGACCCTGAAGCG -3'
(R):5'- AGAAACTGGATAAATGGCCTTATGG -3'

Sequencing Primer
(F):5'- ATGGACCCTGAAGCGATCGTG -3'
(R):5'- TCCCTGTGGAAGCAAACT -3'

Posted On

2017-02-15