Incidental Mutation 'R5888:Iqgap2'
ID457825
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5888 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95635610 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1354 (K1354E)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068603
AA Change: K1354E

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: K1354E

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.1101 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCAACAAAGGTCTAGGTGG -3'
(R):5'- CTTTGGCCAAATTAGGTCCAG -3'

Sequencing Primer
(F):5'- TCTAGGTGGAAAAGAAAGCTATTCCC -3'
(R):5'- GGCCAAATTAGGTCCAGTATTACATC -3'
Posted On2017-02-15