Incidental Mutation 'R5888:Tnk2'
ID 457835
Institutional Source Beutler Lab
Gene Symbol Tnk2
Ensembl Gene ENSMUSG00000022791
Gene Name tyrosine kinase, non-receptor, 2
Synonyms activated p21cdc42Hs kinase, P21cdc42Hs kinase, Ack, Pyk1, ACK1
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.525) question?
Stock # R5888 (G1)
Quality Score 140
Status Validated
Chromosome 16
Chromosomal Location 32462699-32502311 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32490185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 363 (V363I)
Ref Sequence ENSEMBL: ENSMUSP00000110778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115120] [ENSMUST00000115121] [ENSMUST00000115122] [ENSMUST00000115123] [ENSMUST00000115124] [ENSMUST00000115125] [ENSMUST00000115126] [ENSMUST00000131238] [ENSMUST00000145627] [ENSMUST00000152361]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000115120
SMART Domains Protein: ENSMUSP00000110773
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1.1e-8 PFAM
low complexity region 247 264 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 284 351 2.9e-30 PFAM
low complexity region 391 419 N/A INTRINSIC
Pfam:UBA 467 505 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115121
SMART Domains Protein: ENSMUSP00000110774
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 4.5e-9 PFAM
low complexity region 27 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115122
Predicted Effect possibly damaging
Transcript: ENSMUST00000115123
AA Change: V363I

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791
AA Change: V363I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115124
AA Change: V363I

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791
AA Change: V363I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115125
AA Change: V363I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791
AA Change: V363I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115126
AA Change: V363I

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791
AA Change: V363I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131238
SMART Domains Protein: ENSMUSP00000129382
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141256
Predicted Effect probably benign
Transcript: ENSMUST00000145627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164358
Predicted Effect probably benign
Transcript: ENSMUST00000152361
SMART Domains Protein: ENSMUSP00000125905
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
SCOP:d1jo8a_ 8 38 2e-3 SMART
Pfam:GTPase_binding 39 106 2.8e-38 PFAM
Meta Mutation Damage Score 0.1061 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Asap2 T A 12: 21,268,191 (GRCm39) I319N probably damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Kpna7 A G 5: 144,926,605 (GRCm39) F449S probably damaging Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Lair1 A T 7: 4,013,844 (GRCm39) D134E probably damaging Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mdc1 T A 17: 36,158,712 (GRCm39) V364E probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Thsd7b T A 1: 130,138,057 (GRCm39) Y1578* probably null Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Tnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tnk2 APN 16 32,499,498 (GRCm39) missense probably damaging 0.99
IGL02212:Tnk2 APN 16 32,498,960 (GRCm39) missense probably damaging 0.97
IGL02445:Tnk2 APN 16 32,494,408 (GRCm39) missense probably benign 0.00
junior UTSW 16 32,498,903 (GRCm39) missense probably benign
Rookie UTSW 16 32,498,603 (GRCm39) missense probably damaging 1.00
IGL02799:Tnk2 UTSW 16 32,484,699 (GRCm39) splice site probably benign
R0310:Tnk2 UTSW 16 32,499,408 (GRCm39) missense probably benign
R0989:Tnk2 UTSW 16 32,499,176 (GRCm39) missense probably damaging 1.00
R1556:Tnk2 UTSW 16 32,489,737 (GRCm39) critical splice donor site probably null
R1851:Tnk2 UTSW 16 32,498,280 (GRCm39) missense probably damaging 1.00
R1854:Tnk2 UTSW 16 32,498,960 (GRCm39) missense probably damaging 0.97
R1938:Tnk2 UTSW 16 32,482,560 (GRCm39) start gained probably benign
R2137:Tnk2 UTSW 16 32,489,620 (GRCm39) splice site probably null
R2189:Tnk2 UTSW 16 32,490,239 (GRCm39) missense probably damaging 1.00
R3772:Tnk2 UTSW 16 32,498,640 (GRCm39) missense probably damaging 1.00
R4037:Tnk2 UTSW 16 32,489,614 (GRCm39) missense probably damaging 1.00
R4413:Tnk2 UTSW 16 32,488,319 (GRCm39) missense probably damaging 1.00
R4751:Tnk2 UTSW 16 32,498,675 (GRCm39) missense probably damaging 1.00
R4878:Tnk2 UTSW 16 32,498,448 (GRCm39) missense probably damaging 1.00
R4983:Tnk2 UTSW 16 32,499,283 (GRCm39) missense probably damaging 1.00
R5063:Tnk2 UTSW 16 32,489,668 (GRCm39) missense probably damaging 1.00
R5541:Tnk2 UTSW 16 32,488,341 (GRCm39) missense probably benign 0.07
R5759:Tnk2 UTSW 16 32,499,482 (GRCm39) missense probably benign
R6142:Tnk2 UTSW 16 32,488,917 (GRCm39) missense probably damaging 1.00
R6372:Tnk2 UTSW 16 32,498,603 (GRCm39) missense probably damaging 1.00
R6717:Tnk2 UTSW 16 32,489,687 (GRCm39) missense probably damaging 1.00
R6939:Tnk2 UTSW 16 32,482,696 (GRCm39) missense probably damaging 1.00
R7157:Tnk2 UTSW 16 32,499,986 (GRCm39) missense probably damaging 1.00
R7292:Tnk2 UTSW 16 32,499,618 (GRCm39) missense probably benign
R7362:Tnk2 UTSW 16 32,494,338 (GRCm39) critical splice acceptor site probably null
R7477:Tnk2 UTSW 16 32,496,709 (GRCm39) splice site probably null
R7558:Tnk2 UTSW 16 32,498,903 (GRCm39) missense probably benign
R7665:Tnk2 UTSW 16 32,499,344 (GRCm39) missense probably damaging 1.00
R7731:Tnk2 UTSW 16 32,488,952 (GRCm39) missense possibly damaging 0.69
R7867:Tnk2 UTSW 16 32,500,053 (GRCm39) missense probably damaging 0.99
R8011:Tnk2 UTSW 16 32,487,183 (GRCm39) missense probably benign 0.00
R8167:Tnk2 UTSW 16 32,499,080 (GRCm39) missense probably damaging 1.00
R8738:Tnk2 UTSW 16 32,484,718 (GRCm39) missense probably damaging 1.00
R9241:Tnk2 UTSW 16 32,488,916 (GRCm39) missense probably damaging 1.00
R9267:Tnk2 UTSW 16 32,494,489 (GRCm39) missense probably damaging 1.00
R9504:Tnk2 UTSW 16 32,498,961 (GRCm39) missense possibly damaging 0.94
R9643:Tnk2 UTSW 16 32,489,018 (GRCm39) missense probably damaging 1.00
R9786:Tnk2 UTSW 16 32,498,875 (GRCm39) nonsense probably null
X0063:Tnk2 UTSW 16 32,489,668 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGATGGTATCTTCAGCTGTAGG -3'
(R):5'- ATGTGCAGTTTATCTGGCTCC -3'

Sequencing Primer
(F):5'- GTATCTTCAGCTGTAGGACAGG -3'
(R):5'- TGGCTCCTCAAAGTCCTGAAGAG -3'
Posted On 2017-02-15