Incidental Mutation 'R5888:Zfp677'
ID 457837
Institutional Source Beutler Lab
Gene Symbol Zfp677
Ensembl Gene ENSMUSG00000062743
Gene Name zinc finger protein 677
Synonyms A830058L05Rik
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 21383748-21399265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21398258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 526 (C526S)
Ref Sequence ENSEMBL: ENSMUSP00000125295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056107] [ENSMUST00000162659]
AlphaFold Q6PEP4
Predicted Effect probably damaging
Transcript: ENSMUST00000056107
AA Change: C526S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052667
Gene: ENSMUSG00000062743
AA Change: C526S

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162659
AA Change: C526S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125295
Gene: ENSMUSG00000062743
AA Change: C526S

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
Pfam:zf-H2C2_2 118 140 2.9e-5 PFAM
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232365
Meta Mutation Damage Score 0.7649 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Thsd7b T A 1: 130,210,320 Y1578* probably null Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Zfp677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfp677 APN 17 21397668 missense probably benign 0.33
IGL01973:Zfp677 APN 17 21396907 missense probably damaging 1.00
IGL02206:Zfp677 APN 17 21393237 missense probably damaging 1.00
IGL03240:Zfp677 APN 17 21396873 missense probably damaging 0.99
IGL03409:Zfp677 APN 17 21396845 missense probably damaging 1.00
R0622:Zfp677 UTSW 17 21397700 missense probably benign 0.04
R0972:Zfp677 UTSW 17 21398310 missense probably damaging 1.00
R1519:Zfp677 UTSW 17 21397237 missense possibly damaging 0.91
R2155:Zfp677 UTSW 17 21397708 missense probably benign 0.01
R2316:Zfp677 UTSW 17 21397320 missense probably benign 0.38
R2866:Zfp677 UTSW 17 21397256 nonsense probably null
R2989:Zfp677 UTSW 17 21396852 missense probably benign 0.11
R3955:Zfp677 UTSW 17 21397817 missense possibly damaging 0.95
R4075:Zfp677 UTSW 17 21398159 missense probably damaging 1.00
R4134:Zfp677 UTSW 17 21397781 missense probably benign 0.01
R4229:Zfp677 UTSW 17 21398282 missense probably damaging 1.00
R4729:Zfp677 UTSW 17 21397418 missense possibly damaging 0.51
R4843:Zfp677 UTSW 17 21392526 missense probably benign 0.23
R5023:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
R5316:Zfp677 UTSW 17 21397148 missense probably damaging 0.99
R5420:Zfp677 UTSW 17 21397913 missense probably damaging 1.00
R5694:Zfp677 UTSW 17 21397759 missense probably damaging 0.99
R5837:Zfp677 UTSW 17 21397386 missense probably damaging 1.00
R6007:Zfp677 UTSW 17 21397656 missense probably damaging 1.00
R6119:Zfp677 UTSW 17 21397808 missense possibly damaging 0.55
R6190:Zfp677 UTSW 17 21397268 missense possibly damaging 0.91
R6518:Zfp677 UTSW 17 21398130 missense probably damaging 1.00
R7198:Zfp677 UTSW 17 21398417 missense probably damaging 1.00
R7391:Zfp677 UTSW 17 21398391 missense possibly damaging 0.56
R7801:Zfp677 UTSW 17 21398015 missense probably damaging 1.00
R7808:Zfp677 UTSW 17 21397385 missense probably damaging 1.00
R8202:Zfp677 UTSW 17 21393273 missense probably damaging 1.00
R8206:Zfp677 UTSW 17 21392455 splice site probably null
R8885:Zfp677 UTSW 17 21398088 missense probably benign
R8965:Zfp677 UTSW 17 21396893 missense probably damaging 1.00
R9062:Zfp677 UTSW 17 21392553 critical splice donor site probably null
R9167:Zfp677 UTSW 17 21393198 missense probably damaging 1.00
R9371:Zfp677 UTSW 17 21397791 missense probably damaging 1.00
R9638:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
R9752:Zfp677 UTSW 17 21398249 missense probably damaging 1.00
RF003:Zfp677 UTSW 17 21397442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATCCTGGAGAGAAGCCTT -3'
(R):5'- CTGATGCCTTCTAAATGACGAATGG -3'

Sequencing Primer
(F):5'- CCCTACAAGTGCAACATTTGTGG -3'
(R):5'- AGGACCTGTCACAGTCATTG -3'
Posted On 2017-02-15