Incidental Mutation 'R5888:Mdc1'
ID 457840
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Name mediator of DNA damage checkpoint 1
Synonyms NFBD1
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 36152407-36170562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36158712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 364 (V364E)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: V364E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: V364E

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.0816 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Asap2 T A 12: 21,268,191 (GRCm39) I319N probably damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Kpna7 A G 5: 144,926,605 (GRCm39) F449S probably damaging Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Lair1 A T 7: 4,013,844 (GRCm39) D134E probably damaging Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Thsd7b T A 1: 130,138,057 (GRCm39) Y1578* probably null Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Tnk2 G A 16: 32,490,185 (GRCm39) V363I probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 36,158,912 (GRCm39) missense probably benign 0.04
IGL01662:Mdc1 APN 17 36,163,397 (GRCm39) missense probably benign 0.00
IGL01931:Mdc1 APN 17 36,159,123 (GRCm39) missense probably benign 0.00
IGL02542:Mdc1 APN 17 36,164,048 (GRCm39) missense probably damaging 0.96
IGL02823:Mdc1 APN 17 36,163,815 (GRCm39) missense probably damaging 0.99
IGL03411:Mdc1 APN 17 36,164,018 (GRCm39) missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 36,157,083 (GRCm39) missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 36,155,361 (GRCm39) missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 36,159,925 (GRCm39) missense probably benign 0.00
R0129:Mdc1 UTSW 17 36,165,337 (GRCm39) missense probably benign 0.04
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0132:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1597:Mdc1 UTSW 17 36,156,758 (GRCm39) missense probably damaging 1.00
R1721:Mdc1 UTSW 17 36,158,718 (GRCm39) missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1912:Mdc1 UTSW 17 36,161,703 (GRCm39) missense probably benign 0.19
R1912:Mdc1 UTSW 17 36,155,430 (GRCm39) missense probably benign 0.00
R1977:Mdc1 UTSW 17 36,161,822 (GRCm39) missense probably benign 0.01
R2121:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2122:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2357:Mdc1 UTSW 17 36,158,337 (GRCm39) missense probably benign 0.00
R2842:Mdc1 UTSW 17 36,159,686 (GRCm39) missense probably benign 0.01
R2851:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2852:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2964:Mdc1 UTSW 17 36,164,529 (GRCm39) missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 36,158,785 (GRCm39) unclassified probably benign
R3752:Mdc1 UTSW 17 36,156,821 (GRCm39) missense probably damaging 1.00
R4234:Mdc1 UTSW 17 36,159,716 (GRCm39) missense probably benign 0.00
R4641:Mdc1 UTSW 17 36,168,361 (GRCm39) missense probably benign 0.09
R4706:Mdc1 UTSW 17 36,163,671 (GRCm39) missense probably damaging 0.99
R4809:Mdc1 UTSW 17 36,159,993 (GRCm39) critical splice donor site probably null
R4833:Mdc1 UTSW 17 36,161,286 (GRCm39) missense probably benign 0.20
R5032:Mdc1 UTSW 17 36,161,481 (GRCm39) missense probably benign 0.00
R5047:Mdc1 UTSW 17 36,158,736 (GRCm39) missense probably benign 0.00
R5086:Mdc1 UTSW 17 36,159,522 (GRCm39) missense probably benign 0.00
R5172:Mdc1 UTSW 17 36,163,982 (GRCm39) missense probably benign 0.00
R5254:Mdc1 UTSW 17 36,158,814 (GRCm39) missense probably benign 0.00
R5473:Mdc1 UTSW 17 36,158,952 (GRCm39) missense probably benign 0.01
R5550:Mdc1 UTSW 17 36,156,776 (GRCm39) missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 36,159,438 (GRCm39) missense probably benign 0.00
R6020:Mdc1 UTSW 17 36,168,464 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,159,525 (GRCm39) missense probably benign 0.04
R6219:Mdc1 UTSW 17 36,161,566 (GRCm39) missense probably benign 0.10
R7053:Mdc1 UTSW 17 36,157,218 (GRCm39) missense probably benign 0.00
R7073:Mdc1 UTSW 17 36,164,960 (GRCm39) missense probably benign 0.18
R7077:Mdc1 UTSW 17 36,156,839 (GRCm39) missense probably damaging 0.97
R7424:Mdc1 UTSW 17 36,164,201 (GRCm39) missense probably benign 0.04
R7443:Mdc1 UTSW 17 36,161,712 (GRCm39) missense probably damaging 0.98
R7467:Mdc1 UTSW 17 36,155,448 (GRCm39) missense probably benign 0.29
R7549:Mdc1 UTSW 17 36,159,749 (GRCm39) missense probably null 0.04
R7655:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7656:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7960:Mdc1 UTSW 17 36,161,570 (GRCm39) nonsense probably null
R8350:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8450:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8688:Mdc1 UTSW 17 36,161,383 (GRCm39) missense probably benign 0.10
R8726:Mdc1 UTSW 17 36,158,475 (GRCm39) missense probably benign 0.04
R8919:Mdc1 UTSW 17 36,158,843 (GRCm39) missense probably benign 0.00
R8961:Mdc1 UTSW 17 36,159,407 (GRCm39) missense probably benign 0.10
R9324:Mdc1 UTSW 17 36,164,258 (GRCm39) missense probably benign 0.10
R9363:Mdc1 UTSW 17 36,162,019 (GRCm39) missense probably benign 0.00
R9385:Mdc1 UTSW 17 36,161,396 (GRCm39) missense probably benign 0.00
RF025:Mdc1 UTSW 17 36,165,299 (GRCm39) critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 36,161,829 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGAAGATCACAAACCTGGG -3'
(R):5'- TGGCTTTGTTCTACAAGGACCTG -3'

Sequencing Primer
(F):5'- AAACCTGGGTTTGCGGAC -3'
(R):5'- CTACAAGGACCTGTGGTTGGGAC -3'
Posted On 2017-02-15