Incidental Mutation 'R5406:Lrriq3'
ID457870
Institutional Source Beutler Lab
Gene Symbol Lrriq3
Ensembl Gene ENSMUSG00000028182
Gene Nameleucine-rich repeats and IQ motif containing 3
Synonyms4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location155093434-155194280 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 155129501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029833] [ENSMUST00000192383] [ENSMUST00000194376]
Predicted Effect probably null
Transcript: ENSMUST00000029833
SMART Domains Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182

DomainStartEndE-ValueType
SCOP:d1dcea3 36 155 3e-14 SMART
Blast:LRR 71 94 3e-6 BLAST
Blast:LRR 96 118 1e-5 BLAST
IQ 214 236 3.68e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192383
SMART Domains Protein: ENSMUSP00000141372
Gene: ENSMUSG00000028182

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 9e-9 PFAM
Pfam:LRR_4 72 117 1.9e-8 PFAM
Pfam:LRR_1 73 94 5.1e-3 PFAM
IQ 214 236 3.68e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194376
SMART Domains Protein: ENSMUSP00000142127
Gene: ENSMUSG00000028182

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 7.2e-9 PFAM
Pfam:LRR_4 72 117 1.5e-8 PFAM
Pfam:LRR_1 73 94 4.2e-3 PFAM
IQ 214 236 3.68e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Lrriq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrriq3 APN 3 155101061 missense probably benign 0.29
IGL00468:Lrriq3 APN 3 155101179 missense probably damaging 1.00
IGL03272:Lrriq3 APN 3 155101058 missense probably damaging 0.99
PIT1430001:Lrriq3 UTSW 3 155098870 missense probably benign 0.36
R0526:Lrriq3 UTSW 3 155188297 missense probably benign 0.00
R0600:Lrriq3 UTSW 3 155187736 missense possibly damaging 0.51
R1420:Lrriq3 UTSW 3 155187712 missense probably benign
R2313:Lrriq3 UTSW 3 155164023 missense probably benign 0.00
R4024:Lrriq3 UTSW 3 155188302 missense probably benign 0.43
R4659:Lrriq3 UTSW 3 155129453 missense possibly damaging 0.47
R4801:Lrriq3 UTSW 3 155187970 missense probably benign
R4802:Lrriq3 UTSW 3 155187970 missense probably benign
R4864:Lrriq3 UTSW 3 155187810 missense possibly damaging 0.91
R4998:Lrriq3 UTSW 3 155188058 missense probably benign 0.13
R5120:Lrriq3 UTSW 3 155129384 missense probably benign 0.14
R5319:Lrriq3 UTSW 3 155129471 missense possibly damaging 0.88
R5943:Lrriq3 UTSW 3 155163950 missense probably damaging 0.99
R6184:Lrriq3 UTSW 3 155129402 missense probably benign 0.09
R6572:Lrriq3 UTSW 3 155181675 missense probably benign 0.01
R7389:Lrriq3 UTSW 3 155188104 missense probably benign 0.00
R7537:Lrriq3 UTSW 3 155101097 missense probably damaging 1.00
R7636:Lrriq3 UTSW 3 155188150 missense probably damaging 1.00
R7806:Lrriq3 UTSW 3 155098807 missense probably damaging 0.99
R8038:Lrriq3 UTSW 3 155164001 missense probably benign 0.03
R8361:Lrriq3 UTSW 3 155101218 nonsense probably null
R8439:Lrriq3 UTSW 3 155188236 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACACTGGACTCTCACTGTG -3'
(R):5'- TTACAGAGTGAGCACGGTGC -3'

Sequencing Primer
(F):5'- TCTGCATAGGCAGAAGTG -3'
(R):5'- GCTAAAGCACCATAGAGTGCTATTC -3'
Posted On2017-02-16