Incidental Mutation 'R5421:Cdk6'
ID457876
Institutional Source Beutler Lab
Gene Symbol Cdk6
Ensembl Gene ENSMUSG00000040274
Gene Namecyclin-dependent kinase 6
SynonymsCrk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3341485-3531008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3473120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 180 (V180A)
Ref Sequence ENSEMBL: ENSMUSP00000126024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042410] [ENSMUST00000165117]
Predicted Effect probably damaging
Transcript: ENSMUST00000042410
AA Change: V180A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037925
Gene: ENSMUSG00000040274
AA Change: V180A

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165117
AA Change: V180A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126024
Gene: ENSMUSG00000040274
AA Change: V180A

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199396
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cyclin dependent kinase family of proteins that play important roles in the progression and regulation of the cell cycle. The encoded protein binds to a D-type cyclin to form an active kinase complex to regulate progression through the G1 phase of the cell cycle. Mice lacking the encoded protein exhibit thymic and splenic hypoplasia, and hematopoietic defects such as reduced number of megakaryocytes and erythrocytes. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display hematopoietic abnormalities affecting spleen and thymus size. Female body weight and fertility are also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Cdk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Cdk6 UTSW 5 3344211 start gained probably benign
R0583:Cdk6 UTSW 5 3473183 missense probably damaging 0.99
R1474:Cdk6 UTSW 5 3473217 missense probably benign 0.23
R1538:Cdk6 UTSW 5 3520675 missense probably benign 0.02
R2104:Cdk6 UTSW 5 3344387 missense probably benign 0.16
R3029:Cdk6 UTSW 5 3390817 critical splice donor site probably null
R4886:Cdk6 UTSW 5 3344444 missense possibly damaging 0.82
R4939:Cdk6 UTSW 5 3344377 missense probably null 0.99
R5583:Cdk6 UTSW 5 3344436 missense probably damaging 1.00
R6247:Cdk6 UTSW 5 3344553 unclassified probably null
R7014:Cdk6 UTSW 5 3473152 missense probably damaging 1.00
R7102:Cdk6 UTSW 5 3520709 missense probably damaging 1.00
R7288:Cdk6 UTSW 5 3429001 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAATTTCCTGGCCTGTGG -3'
(R):5'- GCTGTAAGGACCAGGAACAC -3'

Sequencing Primer
(F):5'- AATTTCCTGGCCTGTGGAGTCC -3'
(R):5'- GGGTCTGACCAAGCCCTCAATC -3'
Posted On2017-02-16