Incidental Mutation 'R5578:Cfhr2'
ID457966
Institutional Source Beutler Lab
Gene Symbol Cfhr2
Ensembl Gene ENSMUSG00000033898
Gene Namecomplement factor H-related 2
Synonyms
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139804167-139858702 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 139831068 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 81 (C81*)
Ref Sequence ENSEMBL: ENSMUSP00000142033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094489] [ENSMUST00000194186]
Predicted Effect probably null
Transcript: ENSMUST00000094489
AA Change: C81*
SMART Domains Protein: ENSMUSP00000092065
Gene: ENSMUSG00000033898
AA Change: C81*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
CCP 270 331 1.16e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194186
AA Change: C81*
SMART Domains Protein: ENSMUSP00000142033
Gene: ENSMUSG00000033898
AA Change: C81*

DomainStartEndE-ValueType
CCP 28 81 2.7e-7 SMART
CCP 86 146 6.35e-4 SMART
CCP 150 203 7.57e-11 SMART
CCP 212 266 3.7e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Wdr63 A T 3: 146,097,228 Y69* probably null Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Cfhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cfhr2 APN 1 139831232 missense probably benign 0.09
IGL01721:Cfhr2 APN 1 139813614 missense probably benign 0.00
IGL02160:Cfhr2 APN 1 139810926 missense probably benign
IGL02189:Cfhr2 APN 1 139821759 missense probably damaging 0.98
IGL02802:Cfhr2 APN 1 139811024 intron probably benign
PIT4677001:Cfhr2 UTSW 1 139805379 missense unknown
R0470:Cfhr2 UTSW 1 139821779 missense probably damaging 1.00
R0586:Cfhr2 UTSW 1 139813434 nonsense probably null
R1401:Cfhr2 UTSW 1 139811019 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1728:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1729:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1729:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1730:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1730:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1739:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1739:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1762:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1762:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1779:Cfhr2 UTSW 1 139858645 utr 5 prime probably null
R1783:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1783:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1784:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1784:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R1785:Cfhr2 UTSW 1 139813442 missense probably benign 0.00
R1785:Cfhr2 UTSW 1 139813459 missense probably benign 0.02
R2130:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2131:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2141:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R2142:Cfhr2 UTSW 1 139831155 missense probably benign 0.41
R4626:Cfhr2 UTSW 1 139813576 missense probably damaging 1.00
R4938:Cfhr2 UTSW 1 139813527 missense probably benign 0.02
R5225:Cfhr2 UTSW 1 139821782 missense possibly damaging 0.69
R6144:Cfhr2 UTSW 1 139805415 unclassified probably benign
R6312:Cfhr2 UTSW 1 139831079 missense possibly damaging 0.47
R6370:Cfhr2 UTSW 1 139822327 missense probably damaging 1.00
R6587:Cfhr2 UTSW 1 139810858 missense probably benign 0.01
R7028:Cfhr2 UTSW 1 139831063 critical splice donor site probably null
R7051:Cfhr2 UTSW 1 139810978 missense probably benign 0.00
R7162:Cfhr2 UTSW 1 139813526 missense probably benign 0.08
R7166:Cfhr2 UTSW 1 139831101 nonsense probably null
R7503:Cfhr2 UTSW 1 139831214 missense probably damaging 0.99
R7752:Cfhr2 UTSW 1 139813584 missense probably damaging 1.00
Predicted Primers
Posted On2017-02-16