Incidental Mutation 'R0559:Parp9'
ID45808
Institutional Source Beutler Lab
Gene Symbol Parp9
Ensembl Gene ENSMUSG00000022906
Gene Namepoly (ADP-ribose) polymerase family, member 9
Synonyms
MMRRC Submission 038751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0559 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35938470-35972605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35947992 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 181 (F181L)
Ref Sequence ENSEMBL: ENSMUSP00000110528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023622] [ENSMUST00000114877] [ENSMUST00000114878] [ENSMUST00000122870]
Predicted Effect probably benign
Transcript: ENSMUST00000023622
SMART Domains Protein: ENSMUSP00000023622
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 74 182 1.5e-16 PFAM
PDB:3HKV|B 386 559 3e-9 PDB
SCOP:d1a26_2 403 521 1e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114877
SMART Domains Protein: ENSMUSP00000110527
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
A1pp 121 257 6.75e-33 SMART
A1pp 325 451 9.37e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114878
AA Change: F181L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110528
Gene: ENSMUSG00000022906
AA Change: F181L

DomainStartEndE-ValueType
A1pp 85 221 6.75e-33 SMART
A1pp 289 415 9.37e-9 SMART
PDB:3HKV|B 619 792 4e-8 PDB
SCOP:d1a26_2 636 754 1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153066
Predicted Effect probably benign
Transcript: ENSMUST00000159160
SMART Domains Protein: ENSMUSP00000124098
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 29 100 8.3e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,698,535 I289F probably benign Het
Adam15 G A 3: 89,343,778 A540V probably damaging Het
Adat1 T C 8: 111,982,430 T254A probably damaging Het
Agtpbp1 A G 13: 59,497,000 V684A probably benign Het
Ahi1 A G 10: 21,000,719 probably benign Het
Arl5b T C 2: 15,073,187 Y108H probably damaging Het
Cep85l A G 10: 53,348,501 F331L probably benign Het
Ctnna2 T C 6: 76,915,850 K785E probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dicer1 G A 12: 104,706,301 R896W probably damaging Het
Fbxl19 G T 7: 127,750,218 W160L possibly damaging Het
Gm21319 T A 12: 87,773,453 H112L probably benign Het
H1foo T C 6: 115,947,799 Y89H probably damaging Het
Ipo5 T C 14: 120,938,641 V626A probably damaging Het
Isx A G 8: 74,873,741 K34R probably benign Het
Myh6 T C 14: 54,958,554 E596G probably benign Het
Olfml2a T C 2: 38,959,820 I516T probably damaging Het
Olfr1135 T G 2: 87,671,900 T156P possibly damaging Het
Olfr126 C T 17: 37,850,855 R88* probably null Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pkdcc G A 17: 83,216,025 G187D probably benign Het
Plekhh3 C T 11: 101,164,766 E483K possibly damaging Het
Ptx4 C T 17: 25,123,108 Q186* probably null Het
Qsox2 T A 2: 26,214,157 H287L probably benign Het
Rev3l G A 10: 39,824,487 G1660D probably damaging Het
Scamp1 G T 13: 94,208,182 A217E possibly damaging Het
Slc5a9 T C 4: 111,885,582 I438V probably benign Het
Sort1 T C 3: 108,356,579 F818S probably damaging Het
Srl G A 16: 4,496,978 P267S probably benign Het
Tbc1d1 T C 5: 64,173,793 I105T probably damaging Het
Tifab A G 13: 56,176,247 Y128H probably benign Het
Trp53bp1 A T 2: 121,227,801 S907T probably damaging Het
Ubr1 G A 2: 120,947,883 R225* probably null Het
Upk3bl A G 5: 136,057,476 T89A probably benign Het
Vars T A 17: 35,014,058 C916* probably null Het
Ywhaz T C 15: 36,790,964 E5G possibly damaging Het
Zfp91 T C 19: 12,770,055 D568G probably damaging Het
Zgpat T C 2: 181,380,192 probably benign Het
Other mutations in Parp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Parp9 APN 16 35947998 missense probably damaging 1.00
IGL01365:Parp9 APN 16 35947954 missense possibly damaging 0.71
IGL01628:Parp9 APN 16 35956915 missense possibly damaging 0.58
IGL02274:Parp9 APN 16 35947947 missense probably damaging 1.00
IGL02693:Parp9 APN 16 35956970 missense probably benign 0.01
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R1126:Parp9 UTSW 16 35947740 missense possibly damaging 0.53
R1346:Parp9 UTSW 16 35956897 missense probably benign 0.00
R1472:Parp9 UTSW 16 35953680 missense possibly damaging 0.78
R1642:Parp9 UTSW 16 35967697 missense probably benign 0.37
R1900:Parp9 UTSW 16 35972221 missense probably benign 0.00
R2055:Parp9 UTSW 16 35953614 missense probably damaging 0.97
R3177:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R3277:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R4039:Parp9 UTSW 16 35960047 missense probably damaging 1.00
R4869:Parp9 UTSW 16 35956904 missense probably damaging 0.99
R4950:Parp9 UTSW 16 35948007 missense probably damaging 1.00
R5112:Parp9 UTSW 16 35964313 missense probably damaging 1.00
R5117:Parp9 UTSW 16 35971832 splice site probably null
R5180:Parp9 UTSW 16 35953736 nonsense probably null
R5415:Parp9 UTSW 16 35943382 missense probably damaging 0.97
R5535:Parp9 UTSW 16 35956825 missense probably damaging 0.98
R5727:Parp9 UTSW 16 35964097 nonsense probably null
R5842:Parp9 UTSW 16 35943408 missense possibly damaging 0.46
R5942:Parp9 UTSW 16 35971889 missense possibly damaging 0.90
R6110:Parp9 UTSW 16 35953626 missense possibly damaging 0.86
R6193:Parp9 UTSW 16 35947551 missense possibly damaging 0.64
R6707:Parp9 UTSW 16 35947933 missense probably damaging 1.00
R6957:Parp9 UTSW 16 35948346 missense probably benign 0.00
R7014:Parp9 UTSW 16 35960063 critical splice donor site probably null
R7064:Parp9 UTSW 16 35953672 missense probably benign 0.07
R7205:Parp9 UTSW 16 35956990 missense probably benign 0.00
R7221:Parp9 UTSW 16 35953701 missense probably benign 0.00
R7693:Parp9 UTSW 16 35956912 missense possibly damaging 0.67
R8810:Parp9 UTSW 16 35953611 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCGGAAGCTTGGTGAAAACTG -3'
(R):5'- CTGAGGCGGATTTAAAGGACGCAAC -3'

Sequencing Primer
(F):5'- ACTGGTGGCTTTGAAATCCAAG -3'
(R):5'- CATTGCTCACCAGATGAATCTC -3'
Posted On2013-06-11