Incidental Mutation 'R5628:Map4'
ID458085
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission 043167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5628 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110081847 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000143408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000062368] [ENSMUST00000111991] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165596] [ENSMUST00000165876] [ENSMUST00000196171] [ENSMUST00000197928] [ENSMUST00000198425] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199529] [ENSMUST00000199548] [ENSMUST00000199693] [ENSMUST00000200066]
Predicted Effect probably benign
Transcript: ENSMUST00000035055
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062368
SMART Domains Protein: ENSMUSP00000062622
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
internal_repeat_1 76 123 2.53e-5 PROSPERO
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 268 314 2.53e-5 PROSPERO
low complexity region 321 342 N/A INTRINSIC
DEXDc 461 650 9.66e-29 SMART
low complexity region 679 689 N/A INTRINSIC
HELICc 711 816 1.63e-17 SMART
HA2 879 969 5.16e-22 SMART
Pfam:OB_NTP_bind 984 1134 5.7e-9 PFAM
low complexity region 1200 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111991
SMART Domains Protein: ENSMUSP00000107622
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163979
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164930
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165596
SMART Domains Protein: ENSMUSP00000129174
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165876
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196171
SMART Domains Protein: ENSMUSP00000143616
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 39 86 5.84e-5 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 231 277 5.84e-5 PROSPERO
low complexity region 284 305 N/A INTRINSIC
DEXDc 424 613 9.66e-29 SMART
low complexity region 642 652 N/A INTRINSIC
HELICc 674 779 1.63e-17 SMART
HA2 842 932 5.16e-22 SMART
Pfam:OB_NTP_bind 947 1097 2.8e-9 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196914
Predicted Effect probably benign
Transcript: ENSMUST00000197928
SMART Domains Protein: ENSMUSP00000142549
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198026
Predicted Effect probably benign
Transcript: ENSMUST00000198425
SMART Domains Protein: ENSMUSP00000142659
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198511
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199161
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199332
Predicted Effect probably benign
Transcript: ENSMUST00000199461
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199498
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199529
SMART Domains Protein: ENSMUSP00000142489
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199548
AA Change: T245A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479
AA Change: T245A

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199693
Predicted Effect unknown
Transcript: ENSMUST00000199985
AA Change: T35A
Predicted Effect probably benign
Transcript: ENSMUST00000200066
SMART Domains Protein: ENSMUSP00000143371
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200480
Predicted Effect probably benign
Transcript: ENSMUST00000200593
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,755,710 D671G probably benign Het
Ap3b1 A G 13: 94,477,048 D685G unknown Het
Atp6v1h G A 1: 5,135,889 W358* probably null Het
Atr T A 9: 95,874,226 Y830* probably null Het
B3galnt2 A T 13: 13,995,152 probably null Het
Casz1 T C 4: 148,946,096 Y1191H probably damaging Het
Cdc40 T G 10: 40,851,053 E169D probably benign Het
Cep55 C T 19: 38,069,948 Q330* probably null Het
Clcn1 T C 6: 42,298,889 V315A probably damaging Het
Cmya5 A G 13: 93,089,710 F2957L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dync1li2 T C 8: 104,420,592 N490S possibly damaging Het
Ephb3 T C 16: 21,218,119 Y111H probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fat3 T C 9: 15,966,096 Y3407C probably damaging Het
Fbxw8 A G 5: 118,092,557 V393A probably damaging Het
Fnip1 A T 11: 54,503,633 D965V probably benign Het
Gramd2 T C 9: 59,707,723 M3T probably benign Het
Kctd15 T C 7: 34,640,295 D283G probably damaging Het
Kif9 C T 9: 110,514,553 R547* probably null Het
Mindy4 C T 6: 55,260,594 L385F probably damaging Het
Myo7b A G 18: 31,974,187 C1252R probably benign Het
Myt1l T A 12: 29,811,621 I134N unknown Het
Olfr1022 T A 2: 85,868,805 I71N probably damaging Het
Osgin2 T A 4: 15,998,998 N208I probably benign Het
Polr2b G A 5: 77,313,216 V29M probably damaging Het
Prdm15 T A 16: 97,799,623 M812L probably damaging Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Rev3l T A 10: 39,822,967 N1153K probably damaging Het
Rnf17 A G 14: 56,486,952 probably null Het
Rusc2 C T 4: 43,425,348 T1151M probably damaging Het
Scrib T C 15: 76,049,540 T30A possibly damaging Het
Sephs1 T C 2: 4,889,207 I73T probably benign Het
Sf3b1 C T 1: 54,998,175 A861T probably benign Het
Shq1 A G 6: 100,631,003 W316R probably damaging Het
Slc26a5 T A 5: 21,816,976 D484V probably benign Het
Smg1 C T 7: 118,154,701 probably benign Het
Stard5 T C 7: 83,633,147 I56T probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tmem217 A T 17: 29,526,456 I100N probably damaging Het
Trpm2 C T 10: 77,912,636 R1400Q probably benign Het
Vmn1r82 T G 7: 12,305,278 N41K probably damaging Het
Zfp236 T C 18: 82,657,122 D367G probably damaging Het
Zfyve1 A T 12: 83,574,889 V244E probably benign Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
Predicted Primers
Posted On2017-02-16