Incidental Mutation 'R5050:Jag1'
ID458147
Institutional Source Beutler Lab
Gene Symbol Jag1
Ensembl Gene ENSMUSG00000027276
Gene Namejagged 1
SynonymsABE2, Gsfabe2, Serrate-1, Htu, Ozz, Headturner
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location137081456-137116644 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137085154 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 895 (V895A)
Ref Sequence ENSEMBL: ENSMUSP00000028735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028735]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028735
AA Change: V895A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028735
Gene: ENSMUSG00000027276
AA Change: V895A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:MNNL 31 109 2.8e-31 PFAM
DSL 167 229 1.85e-37 SMART
EGF 233 263 1.66e1 SMART
EGF 264 294 2.25e1 SMART
EGF_CA 296 334 4.42e-7 SMART
EGF 339 372 2.64e-5 SMART
EGF_CA 374 410 2.89e-11 SMART
EGF_CA 412 448 2.8e-9 SMART
EGF_CA 450 485 2.31e-10 SMART
EGF_CA 487 523 1.69e-12 SMART
EGF_CA 525 561 4.19e-8 SMART
EGF 577 627 2.16e-1 SMART
EGF_CA 629 665 2.56e-12 SMART
EGF_CA 667 703 6.91e-9 SMART
EGF 708 741 5.88e-3 SMART
EGF 747 780 9.62e-8 SMART
EGF_CA 782 818 3.59e-7 SMART
EGF_CA 820 856 3.81e-11 SMART
VWC 863 930 4.79e-16 SMART
transmembrane domain 1069 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133640
Meta Mutation Damage Score 0.7219 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit extensive hemorrhaging and die prior to embryonic day 11.5, while heterozygotes exhibit defects of the eye. Heterozygotes for missense mutations have inner ear abnormalities. Other mutant mice display abnormal head movements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Jag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Jag1 APN 2 137086032 critical splice acceptor site probably null
IGL00912:Jag1 APN 2 137115573 missense probably damaging 1.00
IGL01104:Jag1 APN 2 137084378 missense probably benign 0.40
IGL01529:Jag1 APN 2 137084977 missense probably damaging 0.99
IGL01578:Jag1 APN 2 137100051 splice site probably benign
IGL01720:Jag1 APN 2 137087103 missense probably damaging 1.00
IGL01809:Jag1 APN 2 137115484 missense probably damaging 1.00
IGL02402:Jag1 APN 2 137085938 missense possibly damaging 0.79
IGL02434:Jag1 APN 2 137087155 missense probably benign 0.01
IGL02543:Jag1 APN 2 137091947 splice site probably benign
IGL02650:Jag1 APN 2 137115585 missense possibly damaging 0.95
IGL03010:Jag1 APN 2 137093198 splice site probably benign
IGL03102:Jag1 APN 2 137084688 missense probably benign 0.00
Grenville UTSW 2 137087142 missense probably damaging 1.00
PIT4651001:Jag1 UTSW 2 137101697 missense probably damaging 1.00
R0227:Jag1 UTSW 2 137115618 missense probably benign
R0306:Jag1 UTSW 2 137085935 missense probably damaging 1.00
R0325:Jag1 UTSW 2 137095445 critical splice donor site probably null
R0594:Jag1 UTSW 2 137087080 missense probably damaging 0.99
R0838:Jag1 UTSW 2 137093278 missense probably damaging 0.98
R0879:Jag1 UTSW 2 137100081 missense possibly damaging 0.80
R0900:Jag1 UTSW 2 137090882 frame shift probably null
R0972:Jag1 UTSW 2 137083451 missense possibly damaging 0.64
R1083:Jag1 UTSW 2 137096232 missense probably damaging 0.99
R1182:Jag1 UTSW 2 137091489 missense probably benign 0.36
R1292:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1464:Jag1 UTSW 2 137115648 missense probably damaging 0.98
R1500:Jag1 UTSW 2 137115638 missense possibly damaging 0.82
R1936:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1937:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1939:Jag1 UTSW 2 137083473 missense possibly damaging 0.79
R1998:Jag1 UTSW 2 137090938 missense probably damaging 1.00
R2019:Jag1 UTSW 2 137084679 missense probably benign 0.37
R2213:Jag1 UTSW 2 137089892 missense probably benign 0.01
R2300:Jag1 UTSW 2 137096315 missense probably damaging 1.00
R2484:Jag1 UTSW 2 137084700 missense possibly damaging 0.86
R4179:Jag1 UTSW 2 137101658 missense probably damaging 0.99
R4212:Jag1 UTSW 2 137085070 missense probably benign
R4630:Jag1 UTSW 2 137085979 missense probably damaging 1.00
R4701:Jag1 UTSW 2 137094456 missense probably benign 0.11
R4705:Jag1 UTSW 2 137096309 missense probably damaging 1.00
R4904:Jag1 UTSW 2 137087142 missense probably damaging 1.00
R5288:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5367:Jag1 UTSW 2 137085094 missense possibly damaging 0.90
R5385:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5386:Jag1 UTSW 2 137095544 missense possibly damaging 0.75
R5430:Jag1 UTSW 2 137101706 missense possibly damaging 0.94
R5472:Jag1 UTSW 2 137084995 missense probably damaging 1.00
R5755:Jag1 UTSW 2 137088690 missense probably damaging 1.00
R5764:Jag1 UTSW 2 137089247 missense probably damaging 1.00
R5804:Jag1 UTSW 2 137088204 missense probably benign 0.01
R6406:Jag1 UTSW 2 137087643 missense probably damaging 1.00
R6503:Jag1 UTSW 2 137101629 missense probably damaging 1.00
R6721:Jag1 UTSW 2 137094474 missense probably benign 0.00
R6826:Jag1 UTSW 2 137116175 critical splice donor site probably null
R7055:Jag1 UTSW 2 137115489 missense probably benign 0.26
R7214:Jag1 UTSW 2 137106882 missense probably benign 0.00
R7359:Jag1 UTSW 2 137084306 missense probably benign
R7422:Jag1 UTSW 2 137085055 missense probably benign
RF016:Jag1 UTSW 2 137096256 missense probably benign 0.01
Z1088:Jag1 UTSW 2 137085151 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTGAAAGTGATGTTTGCACAG -3'
(R):5'- ATCTTGCATCACCATGGGGAG -3'

Sequencing Primer
(F):5'- TGCACAGTTATCCTGGTAATAGG -3'
(R):5'- CATCACCATGGGGAGAGTGATACTTG -3'
Posted On2017-02-17