Incidental Mutation 'R5050:Kazn'
ID458148
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Namekazrin, periplakin interacting protein
Synonyms
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5050 (G1)
Quality Score48
Status Validated
Chromosome4
Chromosomal Location142102390-142239401 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 142118203 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135922
Predicted Effect unknown
Transcript: ENSMUST00000155023
AA Change: H357Y
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: H357Y

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173068
SMART Domains Protein: ENSMUSP00000134498
Gene: ENSMUSG00000040606

DomainStartEndE-ValueType
coiled coil region 1 74 N/A INTRINSIC
low complexity region 194 201 N/A INTRINSIC
Meta Mutation Damage Score 0.2081 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 142159043 critical splice donor site probably null
IGL01959:Kazn APN 4 142150884 missense probably damaging 1.00
IGL02237:Kazn APN 4 142147099 missense probably benign 0.31
IGL02351:Kazn APN 4 142147016 critical splice donor site probably null
IGL02358:Kazn APN 4 142147016 critical splice donor site probably null
R1173:Kazn UTSW 4 142159038 splice site probably benign
R2206:Kazn UTSW 4 142118292 splice site probably null
R3406:Kazn UTSW 4 142239195 start gained probably benign
R4007:Kazn UTSW 4 142106892 missense unknown
R4050:Kazn UTSW 4 142106904 missense unknown
R4598:Kazn UTSW 4 142210092 missense possibly damaging 0.53
R4606:Kazn UTSW 4 142118288 splice site probably null
R4631:Kazn UTSW 4 142118160 unclassified probably benign
R4866:Kazn UTSW 4 142104905 missense unknown
R5052:Kazn UTSW 4 142118203 unclassified probably benign
R5054:Kazn UTSW 4 142108646 missense unknown
R5758:Kazn UTSW 4 142141671 critical splice donor site probably null
R6152:Kazn UTSW 4 142109287 missense unknown
R6284:Kazn UTSW 4 142117197 missense probably benign 0.04
R7289:Kazn UTSW 4 142117175 missense
R7414:Kazn UTSW 4 142109338 missense
R7663:Kazn UTSW 4 142104898 missense
R7814:Kazn UTSW 4 142210170 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTATAACAGTCCCAGGAG -3'
(R):5'- TTGCCTCTTTGGGGAAGCAG -3'

Sequencing Primer
(F):5'- CAGGAGGGTTCAGAGGCATACC -3'
(R):5'- GTACCAGGAGAGCCACTTTG -3'
Posted On2017-02-17