Mutagenetix > Incidental Mutations

Incidental Mutation 'R5050:Mroh2b'

458151

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

042640-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R5050 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4900450 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 6 (D6V)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045736
AA Change: D6V

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: D6V

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226277

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.7%
20x: 93.6%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	G	19: 9,012,458		probably benign	Het
Ap3m1	A	G	14: 21,044,775	I108T	probably benign	Het
Apobec1	T	C	6: 122,591,102	M1V	probably null	Het
Aqr	A	T	2: 114,112,609	L1161*	probably null	Het
Aqr	A	T	2: 114,170,025		probably null	Het
Arhgef37	A	G	18: 61,504,331	I420T	probably benign	Het
Cacna1g	C	T	11: 94,459,715	E435K	probably damaging	Het
Card6	G	T	15: 5,100,376	H513N	probably benign	Het
Ccdc158	A	C	5: 92,666,879	F29L	probably benign	Het
Ccr6	T	C	17: 8,256,104	L47S	probably damaging	Het
Cdc42bpa	T	A	1: 180,072,453	Y444*	probably null	Het
Cdh17	A	G	4: 11,784,654	Y270C	probably damaging	Het
Cdh9	T	C	15: 16,778,147	F16S	probably benign	Het
Cdkl1	T	C	12: 69,757,240	K141R	probably damaging	Het
Chd4	T	C	6: 125,107,480	Y692H	probably damaging	Het
Dhrs7	T	A	12: 72,657,410	D104V	probably damaging	Het
Dhtkd1	A	T	2: 5,917,689	L553Q	probably benign	Het
Dnah7a	T	G	1: 53,497,096	D2596A	probably benign	Het
Dync1li2	T	C	8: 104,437,441	K151E	probably damaging	Het
Eno4	C	T	19: 58,955,496	H297Y	probably benign	Het
Epg5	T	A	18: 77,975,941	D976E	possibly damaging	Het
Fam160b1	T	A	19: 57,383,170	F571L	probably damaging	Het
Gm1966	T	C	7: 106,596,972		noncoding transcript	Het
Gm4553	C	A	7: 142,165,036	K218N	unknown	Het
Gm4788	T	A	1: 139,736,840	I494F	probably damaging	Het
Gpld1	A	T	13: 24,962,756	T234S	probably benign	Het
Gtpbp6	A	T	5: 110,104,701		probably benign	Het
Gucy2g	T	C	19: 55,240,935	E101G	probably benign	Het
Hira	G	A	16: 18,925,859	R442K	possibly damaging	Het
Hrh3	A	G	2: 180,100,557	L394P	probably damaging	Het
Igkv1-110	T	A	6: 68,271,192	F95Y	probably damaging	Het
Iqgap3	T	G	3: 88,090,186	V223G	probably damaging	Het
Itpk1	T	C	12: 102,704,810	T3A	probably damaging	Het
Jag1	A	G	2: 137,085,154	V895A	possibly damaging	Het
Kazn	G	A	4: 142,118,203		probably benign	Het
Large2	A	T	2: 92,367,779	L282Q	probably benign	Het
Lgmn	A	G	12: 102,403,421		probably null	Het
Lrp4	A	T	2: 91,492,422	I1119F	probably benign	Het
Map3k19	T	C	1: 127,823,562	H684R	probably benign	Het
Mier3	C	T	13: 111,714,573	A367V	possibly damaging	Het
Mpdz	A	G	4: 81,295,448	V1579A	probably benign	Het
Myh7b	A	G	2: 155,631,750	I1568V	probably benign	Het
Olfr675	T	A	7: 105,024,387	I198F	probably damaging	Het
Plch2	C	T	4: 155,043,309		probably benign	Het
Plek	T	C	11: 16,995,216	D38G	probably damaging	Het
Polr2f	A	G	15: 79,144,662		probably benign	Het
Samsn1	A	G	16: 75,888,757	S38P	probably benign	Het
Sf1	C	T	19: 6,372,559	T248I	probably damaging	Het
Sgms2	C	T	3: 131,330,356	V232M	probably benign	Het
Sharpin	A	T	15: 76,348,330	L160H	probably damaging	Het
Sympk	C	T	7: 19,036,042	R215C	probably benign	Het
Syn3	T	C	10: 86,407,668	T136A	probably benign	Het
Tcam1	G	A	11: 106,285,452	V335M	possibly damaging	Het
Tedc1	G	T	12: 113,156,705	V56L	possibly damaging	Het
Tenm4	T	C	7: 96,895,788	L2337P	probably damaging	Het
Ttn	G	A	2: 76,884,811		probably benign	Het
Tysnd1	T	A	10: 61,696,271	I234N	probably damaging	Het
Vmn2r51	T	C	7: 10,100,422	K230E	probably damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	intron	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7931:Mroh2b	UTSW	15	4938379	nonsense	probably null
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGCATCTGATAGTTTCAAGTCCTG -3'
(R):5'- TCTCCACATCTGCCTACATAGAG -3'

Sequencing Primer
(F):5'- ATCTGATAGTTTCAAGTCCTGTAGGG -3'
(R):5'- CCACATCTGCCTACATAGAGTTATG -3'

Posted On

2017-02-17