Incidental Mutation 'R5054:Obi1'
ID 458158
Institutional Source Beutler Lab
Gene Symbol Obi1
Ensembl Gene ENSMUSG00000022120
Gene Name ORC ubiquitin ligase 1
Synonyms 2610206B13Rik, 2810449K13Rik, Rnf219
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 104714972-104760081 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104745466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 70 (G70E)
Ref Sequence ENSEMBL: ENSMUSP00000154655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022716] [ENSMUST00000227640] [ENSMUST00000228210] [ENSMUST00000228448]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022716
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120
AA Change: G70E

DomainStartEndE-ValueType
RING 18 55 2.78e-3 SMART
coiled coil region 87 129 N/A INTRINSIC
coiled coil region 157 263 N/A INTRINSIC
low complexity region 302 319 N/A INTRINSIC
low complexity region 647 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227640
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228210
Predicted Effect probably damaging
Transcript: ENSMUST00000228448
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Birc6 A G 17: 74,962,320 (GRCm39) H3978R probably damaging Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Obi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Obi1 APN 14 104,716,823 (GRCm39) nonsense probably null
IGL01731:Obi1 APN 14 104,716,738 (GRCm39) missense probably damaging 1.00
I2505:Obi1 UTSW 14 104,740,885 (GRCm39) splice site probably benign
IGL03098:Obi1 UTSW 14 104,716,253 (GRCm39) missense possibly damaging 0.93
PIT4651001:Obi1 UTSW 14 104,743,692 (GRCm39) missense probably damaging 0.99
R0047:Obi1 UTSW 14 104,740,780 (GRCm39) splice site probably null
R0047:Obi1 UTSW 14 104,740,780 (GRCm39) splice site probably null
R0394:Obi1 UTSW 14 104,716,289 (GRCm39) missense possibly damaging 0.74
R0608:Obi1 UTSW 14 104,716,963 (GRCm39) missense probably damaging 1.00
R0727:Obi1 UTSW 14 104,717,624 (GRCm39) missense probably damaging 1.00
R1109:Obi1 UTSW 14 104,717,200 (GRCm39) nonsense probably null
R1774:Obi1 UTSW 14 104,717,098 (GRCm39) missense possibly damaging 0.68
R1922:Obi1 UTSW 14 104,716,622 (GRCm39) missense probably benign 0.02
R2018:Obi1 UTSW 14 104,759,978 (GRCm39) missense probably damaging 1.00
R2061:Obi1 UTSW 14 104,759,968 (GRCm39) splice site probably benign
R2182:Obi1 UTSW 14 104,743,612 (GRCm39) missense possibly damaging 0.55
R2336:Obi1 UTSW 14 104,716,318 (GRCm39) missense probably damaging 1.00
R4308:Obi1 UTSW 14 104,717,029 (GRCm39) missense probably damaging 0.97
R4355:Obi1 UTSW 14 104,716,693 (GRCm39) missense probably benign 0.01
R4703:Obi1 UTSW 14 104,743,644 (GRCm39) missense probably benign 0.03
R4738:Obi1 UTSW 14 104,747,819 (GRCm39) missense probably damaging 1.00
R4739:Obi1 UTSW 14 104,747,819 (GRCm39) missense probably damaging 1.00
R4869:Obi1 UTSW 14 104,716,252 (GRCm39) missense probably damaging 0.99
R5025:Obi1 UTSW 14 104,745,466 (GRCm39) missense probably damaging 1.00
R5167:Obi1 UTSW 14 104,716,223 (GRCm39) missense probably damaging 1.00
R6356:Obi1 UTSW 14 104,716,313 (GRCm39) missense probably damaging 0.99
R6427:Obi1 UTSW 14 104,717,662 (GRCm39) missense possibly damaging 0.70
R6482:Obi1 UTSW 14 104,717,253 (GRCm39) nonsense probably null
R6518:Obi1 UTSW 14 104,716,501 (GRCm39) missense probably damaging 1.00
R6619:Obi1 UTSW 14 104,759,993 (GRCm39) missense possibly damaging 0.88
R6731:Obi1 UTSW 14 104,716,910 (GRCm39) missense probably benign 0.06
R6754:Obi1 UTSW 14 104,740,850 (GRCm39) missense probably damaging 1.00
R6812:Obi1 UTSW 14 104,747,868 (GRCm39) missense unknown
R7225:Obi1 UTSW 14 104,717,294 (GRCm39) missense probably benign 0.00
R7567:Obi1 UTSW 14 104,716,814 (GRCm39) missense probably damaging 1.00
R8133:Obi1 UTSW 14 104,716,681 (GRCm39) nonsense probably null
R8322:Obi1 UTSW 14 104,717,091 (GRCm39) missense probably damaging 1.00
R8682:Obi1 UTSW 14 104,717,669 (GRCm39) missense probably damaging 0.99
R8780:Obi1 UTSW 14 104,717,082 (GRCm39) nonsense probably null
R8986:Obi1 UTSW 14 104,745,418 (GRCm39) missense probably damaging 1.00
X0002:Obi1 UTSW 14 104,745,413 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGGCTCTAAGATGCATGGAC -3'
(R):5'- AGATCCTGTTTGAAACTCTTCTCAC -3'

Sequencing Primer
(F):5'- CTCTAAGATGCATGGACACTTGGAC -3'
(R):5'- AACTCTTCTCACCTCTCCTAAATCAG -3'
Posted On 2017-02-17