Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Rnf219'

458158

Institutional Source

Beutler Lab

Gene Symbol

Rnf219

Ensembl Gene

ENSMUSG00000022120

Gene Name

ring finger protein 219

Synonyms

2810449K13Rik, 2610206B13Rik

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104477536-104522645 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104508030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 70 (G70E)

Ref Sequence

ENSEMBL: ENSMUSP00000154655 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022716] [ENSMUST00000227640] [ENSMUST00000228210] [ENSMUST00000228448]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022716
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022716
Gene: ENSMUSG00000022120
AA Change: G70E

Domain	Start	End	E-Value	Type
RING	18	55	2.78e-3	SMART
coiled coil region	87	129	N/A	INTRINSIC
coiled coil region	157	263	N/A	INTRINSIC
low complexity region	302	319	N/A	INTRINSIC
low complexity region	647	658	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000227640
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000228210

Predicted Effect

probably damaging
Transcript: ENSMUST00000228448
AA Change: G70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6692

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Rnf219

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01727:Rnf219	APN	14	104479387	nonsense	probably null
IGL01731:Rnf219	APN	14	104479302	missense	probably damaging	1.00
I2505:Rnf219	UTSW	14	104503449	splice site	probably benign
IGL03098:Rnf219	UTSW	14	104478817	missense	possibly damaging	0.93
PIT4651001:Rnf219	UTSW	14	104506256	missense	probably damaging	0.99
R0047:Rnf219	UTSW	14	104503344	splice site	probably null
R0047:Rnf219	UTSW	14	104503344	splice site	probably null
R0394:Rnf219	UTSW	14	104478853	missense	possibly damaging	0.74
R0608:Rnf219	UTSW	14	104479527	missense	probably damaging	1.00
R0727:Rnf219	UTSW	14	104480188	missense	probably damaging	1.00
R1109:Rnf219	UTSW	14	104479764	nonsense	probably null
R1774:Rnf219	UTSW	14	104479662	missense	possibly damaging	0.68
R1922:Rnf219	UTSW	14	104479186	missense	probably benign	0.02
R2018:Rnf219	UTSW	14	104522542	missense	probably damaging	1.00
R2061:Rnf219	UTSW	14	104522532	splice site	probably benign
R2182:Rnf219	UTSW	14	104506176	missense	possibly damaging	0.55
R2336:Rnf219	UTSW	14	104478882	missense	probably damaging	1.00
R4308:Rnf219	UTSW	14	104479593	missense	probably damaging	0.97
R4355:Rnf219	UTSW	14	104479257	missense	probably benign	0.01
R4703:Rnf219	UTSW	14	104506208	missense	probably benign	0.03
R4738:Rnf219	UTSW	14	104510383	missense	probably damaging	1.00
R4739:Rnf219	UTSW	14	104510383	missense	probably damaging	1.00
R4869:Rnf219	UTSW	14	104478816	missense	probably damaging	0.99
R5025:Rnf219	UTSW	14	104508030	missense	probably damaging	1.00
R5167:Rnf219	UTSW	14	104478787	missense	probably damaging	1.00
R6356:Rnf219	UTSW	14	104478877	missense	probably damaging	0.99
R6427:Rnf219	UTSW	14	104480226	missense	possibly damaging	0.70
R6482:Rnf219	UTSW	14	104479817	nonsense	probably null
R6518:Rnf219	UTSW	14	104479065	missense	probably damaging	1.00
R6619:Rnf219	UTSW	14	104522557	missense	possibly damaging	0.88
R6731:Rnf219	UTSW	14	104479474	missense	probably benign	0.06
R6754:Rnf219	UTSW	14	104503414	missense	probably damaging	1.00
R6812:Rnf219	UTSW	14	104510432	missense	unknown
R7225:Rnf219	UTSW	14	104479858	missense	probably benign	0.00
R7567:Rnf219	UTSW	14	104479378	missense	probably damaging	1.00
R8133:Rnf219	UTSW	14	104479245	nonsense	probably null
R8322:Rnf219	UTSW	14	104479655	missense	probably damaging	1.00
R8682:Rnf219	UTSW	14	104480233	missense	probably damaging	0.99
R8780:Rnf219	UTSW	14	104479646	nonsense	probably null
R8986:Rnf219	UTSW	14	104507982	missense	probably damaging	1.00
X0002:Rnf219	UTSW	14	104507977	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTGGCTCTAAGATGCATGGAC -3'
(R):5'- AGATCCTGTTTGAAACTCTTCTCAC -3'

Sequencing Primer
(F):5'- CTCTAAGATGCATGGACACTTGGAC -3'
(R):5'- AACTCTTCTCACCTCTCCTAAATCAG -3'

Posted On

2017-02-17