Incidental Mutation 'R5060:Acvr2a'
ID458163
Institutional Source Beutler Lab
Gene Symbol Acvr2a
Ensembl Gene ENSMUSG00000052155
Gene Nameactivin receptor IIA
SynonymsActRIIa, Acvr2, tActRII
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48814109-48903269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48890299 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 177 (D177G)
Ref Sequence ENSEMBL: ENSMUSP00000067305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063886]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF THE TYPE II ACTIVIN RECEPTOR [X-RAY DIFFRACTION]
Crystal Structure of the BMP7/ActRII Extracellular Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000063886
AA Change: D177G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067305
Gene: ENSMUSG00000052155
AA Change: D177G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Activin_recp 28 118 5e-10 PFAM
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Pkinase_Tyr 192 479 1.2e-31 PFAM
Pfam:Pkinase 196 481 7.6e-34 PFAM
low complexity region 486 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156681
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: While most mice homozygous for targeted mutations that inactivate this gene appear normal, a few display skeletal and facial abnormalities. As adults, follicle-stimulating hormone is suppressed, affecting reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Acvr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Acvr2a APN 2 48873052 splice site probably benign
IGL01551:Acvr2a APN 2 48897059 missense probably damaging 1.00
IGL01913:Acvr2a APN 2 48899613 missense probably damaging 1.00
IGL02100:Acvr2a APN 2 48898618 splice site probably benign
IGL02210:Acvr2a APN 2 48898526 missense probably damaging 0.99
R0864:Acvr2a UTSW 2 48894786 splice site probably benign
R1371:Acvr2a UTSW 2 48899616 missense probably damaging 1.00
R1676:Acvr2a UTSW 2 48873083 missense probably benign 0.00
R2196:Acvr2a UTSW 2 48870312 missense possibly damaging 0.94
R2876:Acvr2a UTSW 2 48892178 missense probably damaging 1.00
R3721:Acvr2a UTSW 2 48892138 missense probably damaging 1.00
R3763:Acvr2a UTSW 2 48870319 missense possibly damaging 0.87
R4401:Acvr2a UTSW 2 48899702 missense probably benign
R4724:Acvr2a UTSW 2 48870435 missense probably damaging 1.00
R4921:Acvr2a UTSW 2 48893541 missense possibly damaging 0.51
R5347:Acvr2a UTSW 2 48892154 missense probably damaging 1.00
R5953:Acvr2a UTSW 2 48890404 missense probably damaging 1.00
R6892:Acvr2a UTSW 2 48897075 missense probably damaging 1.00
R7594:Acvr2a UTSW 2 48894737 nonsense probably null
R7876:Acvr2a UTSW 2 48870427 missense probably benign 0.01
R7959:Acvr2a UTSW 2 48870427 missense probably benign 0.01
Z1088:Acvr2a UTSW 2 48870373 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCTAGCATCTAAGTTCTCG -3'
(R):5'- AGGCTGTTTATGAGCTATAATGTCC -3'

Sequencing Primer
(F):5'- AGCATCTAAGTTCTCGCAGGCTG -3'
(R):5'- GCTATAATGTCCTAACCAGTTACAGC -3'
Posted On2017-02-17