Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03147:Hjurp'

458166

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

IGL03147 (G1)

Quality Score

160

Status

Validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

TGGG to TTGCGGG at 88266280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000054674

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065420

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148384

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

91% (39/43)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,169,229		probably benign	Het
4631405K08Rik	T	A	1: 193,507,460		noncoding transcript	Het
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Ano3	A	G	2: 110,697,418	S552P	probably damaging	Het
Ccser1	A	G	6: 61,312,160	S436G	probably benign	Het
Chek2	A	G	5: 110,848,670	D166G	probably damaging	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Deup1	A	T	9: 15,610,614	M85K	probably damaging	Het
Exo1	A	G	1: 175,888,788	Y157C	probably damaging	Het
Ext1	T	A	15: 53,088,072	I539F	probably damaging	Het
Gcn1l1	T	C	5: 115,610,858	V1849A	possibly damaging	Het
Gpr161	A	G	1: 165,317,308	T389A	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Ncoa1	T	A	12: 4,259,342	Y1318F	probably damaging	Het
Olfr1225	A	G	2: 89,170,972	M80T	probably benign	Het
Pml	T	C	9: 58,230,043	H491R	possibly damaging	Het
Rbmxl2	T	G	7: 107,209,651	S48A	probably benign	Het
Rgs6	A	G	12: 83,091,846	D318G	probably damaging	Het
Sfi1	G	A	11: 3,186,080	T84I	possibly damaging	Het
Slc2a2	A	G	3: 28,719,370	M275V	possibly damaging	Het
Sp110	GC	GCC	1: 85,591,567		probably null	Het
Specc1	T	C	11: 62,118,282	V288A	probably benign	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Srsf11	C	T	3: 158,026,740	V118I	probably damaging	Het
St8sia2	C	A	7: 73,966,819	C136F	probably damaging	Het
Stmn3	A	T	2: 181,309,200	I21N	possibly damaging	Het
Trak2	G	A	1: 58,910,063	T526M	probably benign	Het
Ttn	T	A	2: 76,711,967	K25231N	probably damaging	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vmn1r11	A	T	6: 57,137,665	I68F	probably damaging	Het
Wdr92	G	A	11: 17,229,845	G282E	probably damaging	Het
Zfr	T	A	15: 12,140,552	Y228*	probably null	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1333:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
R1342:Hjurp	UTSW	1	88277368	splice site	probably benign
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1637:Hjurp	UTSW	1	88266121	missense	probably benign	0.03
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2024:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5123:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5318:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
R8968:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9038:Hjurp	UTSW	1	88266524	nonsense	probably null
R9115:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9133:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R9146:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9221:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9475:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9482:Hjurp	UTSW	1	88266274	utr 3 prime	probably benign
R9565:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9599:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCTGCGGCATCATCTGGAG -3'
(R):5'- GGTTGATGACCTTTGCAATGTGAC -3'

Sequencing Primer
(F):5'- ATCATCTGGAGCTCCTTCCAAG -3'
(R):5'- CCTTTGCAATGTGACAATCAGCG -3'

Posted On

2017-02-20