Incidental Mutation 'R5110:Hk1'
ID458168
Institutional Source Beutler Lab
Gene Symbol Hk1
Ensembl Gene ENSMUSG00000037012
Gene Namehexokinase 1
SynonymsmHk1-s, Hk-1, Hk1-s
MMRRC Submission 042698-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R5110 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62268855-62379908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62286651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 422 (Y422N)
Ref Sequence ENSEMBL: ENSMUSP00000118601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130422]
Predicted Effect probably damaging
Transcript: ENSMUST00000072357
AA Change: Y450N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: Y450N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099691
AA Change: Y423N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: Y423N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116238
AA Change: Y450N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: Y450N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130422
AA Change: Y422N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: Y422N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161160
Meta Mutation Damage Score 0.5505 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,357 probably null Het
2310016G11Rik G A 7: 44,677,862 noncoding transcript Het
Abi2 G A 1: 60,450,121 V98I probably benign Het
Adam21 T C 12: 81,560,215 T258A probably benign Het
Adam33 A T 2: 131,053,770 C542S probably damaging Het
Adamts15 A G 9: 30,921,444 V265A probably benign Het
Ahnak A T 19: 9,014,759 D4469V probably damaging Het
Aicda A G 6: 122,561,185 N101D probably benign Het
Als2 A T 1: 59,185,441 D1040E probably damaging Het
Car15 T C 16: 17,835,347 R319G possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col1a1 T C 11: 94,941,593 probably null Het
Col25a1 A G 3: 130,584,725 *594W probably null Het
Cwf19l2 A G 9: 3,450,012 probably null Het
Dctn4 C T 18: 60,546,315 P236S probably damaging Het
Ehmt1 C A 2: 24,852,790 C459F probably benign Het
Enox1 T C 14: 77,707,687 probably null Het
Fam136b-ps A G 15: 31,276,710 probably benign Het
Fzd1 T C 5: 4,756,448 D378G probably benign Het
Golga5 G A 12: 102,472,077 R17Q probably benign Het
Hsf4 A G 8: 105,272,795 D255G probably benign Het
Ift81 A G 5: 122,551,058 V665A probably benign Het
Igkv13-84 T C 6: 68,939,608 F3L probably benign Het
Kcnh1 T A 1: 192,337,747 S433R possibly damaging Het
Ktn1 A G 14: 47,704,287 probably benign Het
Lrp4 A T 2: 91,497,072 D1471V possibly damaging Het
Macf1 A T 4: 123,368,008 D6990E probably damaging Het
Map3k6 G A 4: 133,247,548 probably benign Het
Miox T A 15: 89,335,556 D82E probably benign Het
Olfr722 T G 14: 49,895,575 I76L possibly damaging Het
Ovgp1 G C 3: 105,977,783 R133P probably damaging Het
Per2 G A 1: 91,429,515 T642I possibly damaging Het
Pparg T C 6: 115,473,003 V321A probably damaging Het
Pptc7 T A 5: 122,308,249 N17K probably benign Het
Prpf19 T C 19: 10,899,287 probably benign Het
Rai14 T C 15: 10,690,410 probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Sbf2 T A 7: 110,364,657 T994S probably benign Het
Slc1a1 G A 19: 28,911,808 E494K probably benign Het
Smarcc1 A G 9: 110,197,784 K771E possibly damaging Het
St5 A G 7: 109,542,490 S556P probably benign Het
Stim1 T C 7: 102,268,422 V3A unknown Het
Syne3 G A 12: 104,943,370 R736C probably benign Het
Synj2 T C 17: 6,037,715 V986A probably benign Het
Tinag A G 9: 76,952,007 S440P probably damaging Het
Tshz2 A G 2: 169,884,197 T238A possibly damaging Het
Ttc8 T C 12: 98,942,303 M17T probably benign Het
Tubgcp5 G A 7: 55,808,637 R432Q probably damaging Het
Ugt1a10 T A 1: 88,056,252 probably null Het
Usp4 T A 9: 108,362,678 I202N probably damaging Het
Vmn1r194 T G 13: 22,245,000 S262R probably benign Het
Vmn2r101 T C 17: 19,611,635 F631S possibly damaging Het
Vps13b T A 15: 35,770,809 S2133T probably damaging Het
Zfp13 C A 17: 23,580,860 V77F probably benign Het
Zscan10 T A 17: 23,609,632 C306S probably damaging Het
Other mutations in Hk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Hk1 APN 10 62286348 nonsense probably null
IGL01108:Hk1 APN 10 62296708 missense probably benign 0.00
IGL01810:Hk1 APN 10 62353105 missense probably benign 0.13
IGL01950:Hk1 APN 10 62315394 missense probably damaging 0.99
IGL02165:Hk1 APN 10 62281888 missense probably damaging 1.00
IGL02227:Hk1 APN 10 62281140 splice site probably benign
IGL02257:Hk1 APN 10 62271643 missense probably benign 0.07
IGL02341:Hk1 APN 10 62284380 missense possibly damaging 0.54
IGL02553:Hk1 APN 10 62295773 missense possibly damaging 0.71
IGL02623:Hk1 APN 10 62292359 missense probably benign 0.21
IGL02700:Hk1 APN 10 62284811 missense probably damaging 1.00
IGL02863:Hk1 APN 10 62295755 missense possibly damaging 0.83
IGL03002:Hk1 APN 10 62271799 missense probably damaging 1.00
R0029:Hk1 UTSW 10 62315394 missense probably damaging 0.99
R0436:Hk1 UTSW 10 62299275 splice site probably benign
R0853:Hk1 UTSW 10 62271716 nonsense probably null
R1422:Hk1 UTSW 10 62296094 missense probably null 0.98
R1531:Hk1 UTSW 10 62284784 missense probably damaging 1.00
R1760:Hk1 UTSW 10 62281899 missense probably damaging 1.00
R2064:Hk1 UTSW 10 62286536 missense probably benign 0.03
R3236:Hk1 UTSW 10 62296019 unclassified probably null
R3788:Hk1 UTSW 10 62275688 missense possibly damaging 0.85
R3977:Hk1 UTSW 10 62290319 missense probably benign 0.10
R4373:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4374:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4377:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4435:Hk1 UTSW 10 62275844 missense probably damaging 1.00
R4609:Hk1 UTSW 10 62358415 utr 5 prime probably benign
R4648:Hk1 UTSW 10 62304779 missense probably benign 0.00
R4864:Hk1 UTSW 10 62342539 missense probably benign 0.00
R4934:Hk1 UTSW 10 62358386 utr 5 prime probably benign
R5352:Hk1 UTSW 10 62304770 missense probably damaging 0.97
R5569:Hk1 UTSW 10 62286441 missense probably benign 0.35
R5609:Hk1 UTSW 10 62342551 missense probably benign 0.30
R5647:Hk1 UTSW 10 62275744 missense probably damaging 0.99
R5750:Hk1 UTSW 10 62274466 missense possibly damaging 0.86
R5770:Hk1 UTSW 10 62286449 missense probably benign
R5832:Hk1 UTSW 10 62292365 missense probably benign 0.17
R5905:Hk1 UTSW 10 62353058 missense probably null 0.82
R5933:Hk1 UTSW 10 62269994 missense probably damaging 1.00
R6028:Hk1 UTSW 10 62353058 missense probably null 0.82
R6196:Hk1 UTSW 10 62299259 missense probably damaging 1.00
R6314:Hk1 UTSW 10 62292444 missense possibly damaging 0.93
R6372:Hk1 UTSW 10 62291978 missense probably benign
R6801:Hk1 UTSW 10 62281131 missense probably damaging 0.97
R6838:Hk1 UTSW 10 62271658 missense probably damaging 0.98
R7045:Hk1 UTSW 10 62286570 missense probably damaging 1.00
R7420:Hk1 UTSW 10 62269982 missense probably damaging 1.00
R7491:Hk1 UTSW 10 62295745 missense probably damaging 1.00
R7527:Hk1 UTSW 10 62304782 missense probably damaging 0.99
R7561:Hk1 UTSW 10 62281028 splice site probably null
R8031:Hk1 UTSW 10 62296699 missense not run
X0018:Hk1 UTSW 10 62275706 missense probably benign 0.02
X0063:Hk1 UTSW 10 62275704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTGCTGAGGCGGAAG -3'
(R):5'- GGTTTGGGCCCTCGAATT -3'

Sequencing Primer
(F):5'- AAGTGGGACAGGGTTTCCTCAATC -3'
(R):5'- CCAAGTATGTAGCCTGGT -3'
Posted On2017-02-22