Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Gpr158'

45817

Institutional Source

Beutler Lab

Gene Symbol

Gpr158

Ensembl Gene

ENSMUSG00000045967

Gene Name

G protein-coupled receptor 158

Synonyms

5330427M13Rik

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21367542-21830547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21825274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 710 (D710V)

Ref Sequence

ENSEMBL: ENSMUSP00000049708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055946]

AlphaFold

Q8C419

Predicted Effect

probably damaging
Transcript: ENSMUST00000055946
AA Change: D710V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: D710V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	110	125	N/A	INTRINSIC
SCOP:d1edmb_	313	359	5e-4	SMART
Blast:EGF	318	365	2e-27	BLAST
Pfam:7tm_3	426	669	1.2e-35	PFAM
low complexity region	840	863	N/A	INTRINSIC

Meta Mutation Damage Score

0.4298

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Gpr158

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Gpr158	APN	2	21368683	missense	probably damaging	1.00
IGL00469:Gpr158	APN	2	21746795	splice site	probably benign
IGL00706:Gpr158	APN	2	21746773	missense	probably damaging	1.00
IGL00780:Gpr158	APN	2	21826818	nonsense	probably null
IGL00885:Gpr158	APN	2	21649021	missense	probably damaging	1.00
IGL01339:Gpr158	APN	2	21369031	missense	possibly damaging	0.73
IGL01368:Gpr158	APN	2	21827098	missense	probably damaging	1.00
IGL02141:Gpr158	APN	2	21783290	missense	probably damaging	0.99
IGL02455:Gpr158	APN	2	21368700	missense	probably benign	0.00
IGL02554:Gpr158	APN	2	21826596	missense	probably benign
IGL02681:Gpr158	APN	2	21815630	missense	probably damaging	1.00
IGL02752:Gpr158	APN	2	21826827	missense	possibly damaging	0.95
IGL02756:Gpr158	APN	2	21827079	missense	possibly damaging	0.47
IGL03181:Gpr158	APN	2	21783161	missense	probably benign	0.02
IGL03258:Gpr158	APN	2	21825274	missense	probably damaging	1.00
IGL03386:Gpr158	APN	2	21826246	missense	probably damaging	1.00
PIT4810001:Gpr158	UTSW	2	21826871	missense	probably benign	0.01
R0071:Gpr158	UTSW	2	21810668	missense	probably benign	0.08
R0081:Gpr158	UTSW	2	21826717	missense	probably damaging	1.00
R0528:Gpr158	UTSW	2	21825208	missense	probably damaging	1.00
R0603:Gpr158	UTSW	2	21815669	missense	possibly damaging	0.67
R1560:Gpr158	UTSW	2	21826314	missense	probably damaging	1.00
R1561:Gpr158	UTSW	2	21815694	splice site	probably null
R1609:Gpr158	UTSW	2	21783293	missense	possibly damaging	0.61
R1741:Gpr158	UTSW	2	21827548	missense	probably benign	0.00
R1827:Gpr158	UTSW	2	21827318	missense	probably benign
R1854:Gpr158	UTSW	2	21369124	missense	probably damaging	1.00
R1871:Gpr158	UTSW	2	21815615	missense	probably damaging	1.00
R2151:Gpr158	UTSW	2	21827514	missense	possibly damaging	0.82
R2273:Gpr158	UTSW	2	21826863	missense	probably benign
R2275:Gpr158	UTSW	2	21826863	missense	probably benign
R3004:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R3151:Gpr158	UTSW	2	21576960	missense	possibly damaging	0.68
R3943:Gpr158	UTSW	2	21368559	missense	possibly damaging	0.65
R4238:Gpr158	UTSW	2	21368551	missense	probably damaging	1.00
R4379:Gpr158	UTSW	2	21825214	missense	probably damaging	1.00
R4381:Gpr158	UTSW	2	21827592	missense	probably damaging	1.00
R4464:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4467:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4496:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4506:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4530:Gpr158	UTSW	2	21369000	missense	probably benign	0.03
R4646:Gpr158	UTSW	2	21827053	missense	probably benign
R4798:Gpr158	UTSW	2	21783182	missense	probably damaging	1.00
R4882:Gpr158	UTSW	2	21825248	missense	probably damaging	0.98
R4943:Gpr158	UTSW	2	21827157	missense	probably damaging	1.00
R5334:Gpr158	UTSW	2	21827505	missense	probably benign	0.01
R5560:Gpr158	UTSW	2	21826290	missense	possibly damaging	0.67
R5600:Gpr158	UTSW	2	21827235	missense	probably benign
R5637:Gpr158	UTSW	2	21783272	missense	probably benign	0.00
R5701:Gpr158	UTSW	2	21746709	missense	probably damaging	1.00
R5744:Gpr158	UTSW	2	21368520	missense	probably damaging	1.00
R5911:Gpr158	UTSW	2	21369121	missense	possibly damaging	0.95
R5991:Gpr158	UTSW	2	21368508	missense	probably damaging	0.99
R6200:Gpr158	UTSW	2	21399416	missense	probably damaging	0.97
R6306:Gpr158	UTSW	2	21815611	missense	possibly damaging	0.84
R6324:Gpr158	UTSW	2	21810554	missense	probably damaging	1.00
R6384:Gpr158	UTSW	2	21826288	missense	probably damaging	1.00
R6698:Gpr158	UTSW	2	21827110	missense	probably damaging	1.00
R6997:Gpr158	UTSW	2	21648991	missense	possibly damaging	0.46
R7086:Gpr158	UTSW	2	21826575	missense	probably benign	0.01
R7175:Gpr158	UTSW	2	21368302	missense	probably benign	0.13
R7197:Gpr158	UTSW	2	21810601	missense	probably damaging	0.99
R7293:Gpr158	UTSW	2	21576939	missense	possibly damaging	0.47
R7427:Gpr158	UTSW	2	21827318	missense	probably benign
R7515:Gpr158	UTSW	2	21368281	missense	probably damaging	1.00
R7730:Gpr158	UTSW	2	21826347	missense	probably damaging	1.00
R8122:Gpr158	UTSW	2	21826863	missense	probably benign
R8311:Gpr158	UTSW	2	21368890	missense	probably benign	0.00
R8754:Gpr158	UTSW	2	21576882	missense	probably benign	0.00
R8782:Gpr158	UTSW	2	21399338	missense	probably damaging	1.00
R8792:Gpr158	UTSW	2	21553326	missense	probably damaging	1.00
R8842:Gpr158	UTSW	2	21576940	missense	possibly damaging	0.88
R9009:Gpr158	UTSW	2	21576949	missense	probably damaging	1.00
R9102:Gpr158	UTSW	2	21825267	missense	probably damaging	1.00
R9150:Gpr158	UTSW	2	21826440	missense	probably benign	0.17
R9254:Gpr158	UTSW	2	21368231	start gained	probably benign
R9317:Gpr158	UTSW	2	21827226	missense	probably benign
R9379:Gpr158	UTSW	2	21368231	start gained	probably benign
R9428:Gpr158	UTSW	2	21783161	missense	not run
X0062:Gpr158	UTSW	2	21826369	missense	probably damaging	1.00
Z1176:Gpr158	UTSW	2	21810690	critical splice donor site	probably null
Z1177:Gpr158	UTSW	2	21827272	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- ACTGTCTAGCAATGGGTTGATGGC -3'
(R):5'- TCTCTGCTCATAGGGCGGTCTTAC -3'

Sequencing Primer
(F):5'- GTTGATGGCTACAGCTCACAC -3'
(R):5'- GGCGGTCTTACTTTTTAAAGCAC -3'

Posted On

2013-06-11