Incidental Mutation 'R5173:Psmd11'
ID458188
Institutional Source Beutler Lab
Gene Symbol Psmd11
Ensembl Gene ENSMUSG00000017428
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms1700089D09Rik, 2810055C24Rik, P44.5, C78232, 2610024G20Rik, S9, 1810019E17Rik
MMRRC Submission 042753-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5173 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80428615-80473248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80460740 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 263 (T263I)
Ref Sequence ENSEMBL: ENSMUSP00000133571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000125591] [ENSMUST00000129500] [ENSMUST00000148895] [ENSMUST00000172773] [ENSMUST00000172847] [ENSMUST00000173186] [ENSMUST00000173565] [ENSMUST00000173938] [ENSMUST00000174743]
Predicted Effect probably benign
Transcript: ENSMUST00000017572
AA Change: T263I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428
AA Change: T263I

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125591
SMART Domains Protein: ENSMUSP00000134320
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Pfam:PCI 21 92 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129500
AA Change: T11I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133452
Gene: ENSMUSG00000017428
AA Change: T11I

DomainStartEndE-ValueType
Blast:PAM 1 68 8e-42 BLAST
PINT 69 140 4.38e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147898
Predicted Effect probably benign
Transcript: ENSMUST00000148895
AA Change: T71I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134083
Gene: ENSMUSG00000017428
AA Change: T71I

DomainStartEndE-ValueType
Blast:PAM 1 107 1e-74 BLAST
PINT 108 191 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172773
SMART Domains Protein: ENSMUSP00000134096
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 37 110 7e-24 PDB
Blast:PAM 83 110 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172847
SMART Domains Protein: ENSMUSP00000134136
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 30 99 2e-22 PDB
Blast:PAM 76 99 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173060
SMART Domains Protein: ENSMUSP00000133509
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 29 98 2e-22 PDB
Blast:PAM 75 98 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173186
Predicted Effect probably benign
Transcript: ENSMUST00000173565
SMART Domains Protein: ENSMUSP00000134326
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 1 114 2e-50 PDB
Blast:PAM 45 114 3e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173797
SMART Domains Protein: ENSMUSP00000133739
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
Blast:PAM 2 58 9e-33 BLAST
PINT 59 142 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173938
AA Change: T263I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133571
Gene: ENSMUSG00000017428
AA Change: T263I

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174743
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,100,567 R54* probably null Het
Abca13 AC A 11: 9,682,032 probably null Het
Abca6 A T 11: 110,191,720 F1142L probably benign Het
Ap1g1 T A 8: 109,851,132 probably null Het
Apob T C 12: 8,008,238 V2207A probably benign Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Chd3 A G 11: 69,369,243 probably benign Het
Coch C A 12: 51,596,507 Y103* probably null Het
Cul3 A T 1: 80,281,416 D382E possibly damaging Het
Cul5 T C 9: 53,642,734 T291A probably benign Het
Dab1 T C 4: 104,688,448 probably null Het
Dmtf1 A G 5: 9,140,356 probably benign Het
Dpp4 T C 2: 62,387,130 Y41C probably damaging Het
Eif2ak4 A G 2: 118,408,360 I45M probably damaging Het
Epn3 T C 11: 94,496,097 K149R probably damaging Het
Flnc A G 6: 29,455,538 E2029G probably damaging Het
Gm5799 A G 14: 43,544,659 N96S probably damaging Het
Gm9573 G T 17: 35,620,741 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grik5 T C 7: 25,062,894 H224R possibly damaging Het
Lpar6 A T 14: 73,239,097 E166V probably benign Het
Mical1 T C 10: 41,484,989 L683P probably damaging Het
Mis18bp1 T C 12: 65,149,375 I538M possibly damaging Het
Mobp A G 9: 120,168,245 R77G possibly damaging Het
Mylk A G 16: 34,977,013 H1614R probably benign Het
Olfr1179 G A 2: 88,402,922 T4I probably benign Het
Olfr1388 T C 11: 49,443,886 F12L probably benign Het
Olfr371 T C 8: 85,230,576 L27P probably damaging Het
Osbpl1a C T 18: 12,762,640 V390I probably benign Het
Pcdha7 C A 18: 36,974,652 D243E probably benign Het
Pi4ka A T 16: 17,350,906 N653K possibly damaging Het
Plin5 T G 17: 56,115,548 probably null Het
Plod1 A G 4: 147,916,301 probably benign Het
Psd3 T C 8: 67,696,989 K372E probably damaging Het
Ptprt A T 2: 161,927,756 N396K probably benign Het
Rab39 T C 9: 53,686,500 E155G probably damaging Het
Rimbp2 T C 5: 128,797,648 D293G probably benign Het
Rnf220 T C 4: 117,289,274 probably benign Het
Rnmt C T 18: 68,321,359 probably benign Het
Slc10a1 T A 12: 80,956,028 I279F probably damaging Het
Taar6 A G 10: 23,985,352 Y99H probably damaging Het
Tas2r144 T A 6: 42,216,114 F263I probably benign Het
Tex15 T A 8: 33,571,740 N399K possibly damaging Het
Tlr9 T A 9: 106,225,952 V814D possibly damaging Het
Tmem53 T A 4: 117,265,711 probably benign Het
Ubap2l T C 3: 90,021,030 I511V possibly damaging Het
Vmn2r60 T C 7: 42,195,511 M766T probably damaging Het
Zfp462 T C 4: 55,011,115 V1027A probably damaging Het
Other mutations in Psmd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Psmd11 APN 11 80470384 missense possibly damaging 0.88
IGL03383:Psmd11 APN 11 80469845 missense probably damaging 1.00
R0358:Psmd11 UTSW 11 80462684 splice site probably benign
R0529:Psmd11 UTSW 11 80470689 unclassified probably benign
R1127:Psmd11 UTSW 11 80471584 missense possibly damaging 0.89
R1936:Psmd11 UTSW 11 80428744 missense probably damaging 1.00
R1985:Psmd11 UTSW 11 80445263 missense probably damaging 1.00
R2356:Psmd11 UTSW 11 80428704 missense possibly damaging 0.89
R2994:Psmd11 UTSW 11 80460667 missense probably damaging 1.00
R4898:Psmd11 UTSW 11 80438320 missense probably damaging 1.00
R5234:Psmd11 UTSW 11 80428740 missense probably benign 0.05
R5794:Psmd11 UTSW 11 80471492 missense probably benign 0.00
R6169:Psmd11 UTSW 11 80460713 missense probably damaging 1.00
R6266:Psmd11 UTSW 11 80445941 missense probably benign 0.01
R6275:Psmd11 UTSW 11 80438632 intron probably benign
R7121:Psmd11 UTSW 11 80438273 nonsense probably null
R7318:Psmd11 UTSW 11 80456302 missense probably benign 0.29
Z1088:Psmd11 UTSW 11 80471550 frame shift probably null
Z1176:Psmd11 UTSW 11 80428648 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCAGCTCACTGTCTAGG -3'
(R):5'- GCAGCAAGCGAGATTGTCAG -3'

Sequencing Primer
(F):5'- CTAGACACCTGGGGTTCTAATGC -3'
(R):5'- GCGAGATTGTCAGAGAATTCCTC -3'
Posted On2017-02-24