Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Siglec1'

45819

Institutional Source

Beutler Lab

Gene Symbol

Siglec1

Ensembl Gene

ENSMUSG00000027322

Gene Name

sialic acid binding Ig-like lectin 1, sialoadhesin

Synonyms

Sn, CD169, Siglec-1

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R0560 (G1)

Quality Score

170

Status

Validated

Chromosome

Chromosomal Location

131069220-131086765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 131070346 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 1692 (T1692N)

Ref Sequence

ENSEMBL: ENSMUSP00000028794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]

Predicted Effect

probably benign
Transcript: ENSMUST00000028794
AA Change: T1692N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: T1692N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	9.4e-18	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART
IG_like	1549	1624	1.21e-1	SMART
transmembrane domain	1647	1669	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110227

SMART Domains

Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	7e-17	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART

Meta Mutation Damage Score

0.1129

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Siglec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Siglec1	APN	2	131079325	missense	probably benign	0.03
IGL01092:Siglec1	APN	2	131079217	missense	probably damaging	1.00
IGL01115:Siglec1	APN	2	131074502	missense	probably benign	0.01
IGL01324:Siglec1	APN	2	131085541	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131083536	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131075005	nonsense	probably null
IGL01558:Siglec1	APN	2	131078499	missense	probably damaging	0.96
IGL01632:Siglec1	APN	2	131083820	missense	probably benign	0.03
IGL01768:Siglec1	APN	2	131074394	missense	probably benign
IGL02399:Siglec1	APN	2	131071178	missense	probably benign	0.16
IGL02558:Siglec1	APN	2	131074995	missense	possibly damaging	0.88
IGL02794:Siglec1	APN	2	131075969	missense	possibly damaging	0.86
IGL02839:Siglec1	APN	2	131084932	missense	possibly damaging	0.82
aggressor	UTSW	2	131083941	nonsense	probably null
hoodlum	UTSW	2	131072747	missense	possibly damaging	0.88
K3955:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
P0038:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
PIT4576001:Siglec1	UTSW	2	131078161	missense	probably damaging	1.00
PIT4677001:Siglec1	UTSW	2	131072757	missense	probably damaging	1.00
R0003:Siglec1	UTSW	2	131075060	missense	probably benign	0.00
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0243:Siglec1	UTSW	2	131085476	missense	probably damaging	1.00
R0276:Siglec1	UTSW	2	131083941	nonsense	probably null
R0379:Siglec1	UTSW	2	131074525	splice site	probably benign
R0464:Siglec1	UTSW	2	131079359	missense	probably damaging	1.00
R0507:Siglec1	UTSW	2	131074525	splice site	probably benign
R0620:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0621:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0853:Siglec1	UTSW	2	131085022	missense	probably damaging	0.98
R1079:Siglec1	UTSW	2	131079377	nonsense	probably null
R1169:Siglec1	UTSW	2	131074827	missense	probably damaging	0.97
R1205:Siglec1	UTSW	2	131080464	missense	possibly damaging	0.94
R1293:Siglec1	UTSW	2	131073531	missense	probably benign	0.00
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1533:Siglec1	UTSW	2	131076158	missense	probably benign
R1717:Siglec1	UTSW	2	131073956	missense	possibly damaging	0.92
R1717:Siglec1	UTSW	2	131084012	missense	probably damaging	1.00
R1744:Siglec1	UTSW	2	131081299	missense	probably damaging	1.00
R1852:Siglec1	UTSW	2	131081500	missense	probably damaging	0.98
R1941:Siglec1	UTSW	2	131078131	missense	possibly damaging	0.94
R2011:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2012:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2128:Siglec1	UTSW	2	131080497	missense	probably damaging	1.00
R2278:Siglec1	UTSW	2	131071337	missense	probably benign	0.28
R2403:Siglec1	UTSW	2	131074475	missense	possibly damaging	0.65
R2449:Siglec1	UTSW	2	131078725	missense	probably benign	0.44
R2885:Siglec1	UTSW	2	131072747	missense	possibly damaging	0.88
R4213:Siglec1	UTSW	2	131074118	missense	probably damaging	1.00
R4274:Siglec1	UTSW	2	131085814	missense	probably benign	0.00
R4679:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R4715:Siglec1	UTSW	2	131074436	missense	probably damaging	1.00
R4782:Siglec1	UTSW	2	131075923	missense	probably damaging	1.00
R4896:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R4993:Siglec1	UTSW	2	131073361	missense	possibly damaging	0.93
R5004:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R5004:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R5105:Siglec1	UTSW	2	131080400	missense	possibly damaging	0.69
R5137:Siglec1	UTSW	2	131081344	missense	probably damaging	1.00
R5153:Siglec1	UTSW	2	131085577	missense	probably damaging	0.99
R5311:Siglec1	UTSW	2	131079316	missense	probably damaging	1.00
R5600:Siglec1	UTSW	2	131085583	missense	probably benign	0.01
R5682:Siglec1	UTSW	2	131084010	missense	probably damaging	1.00
R5732:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R5870:Siglec1	UTSW	2	131072847	missense	probably damaging	0.99
R5898:Siglec1	UTSW	2	131073633	missense	probably damaging	1.00
R5909:Siglec1	UTSW	2	131077964	missense	probably damaging	1.00
R6488:Siglec1	UTSW	2	131081307	missense	probably damaging	0.99
R6920:Siglec1	UTSW	2	131078077	nonsense	probably null
R7064:Siglec1	UTSW	2	131083914	missense	probably benign	0.00
R7270:Siglec1	UTSW	2	131081551	missense	possibly damaging	0.67
R7355:Siglec1	UTSW	2	131080451	missense	probably benign	0.02
R7400:Siglec1	UTSW	2	131086095	missense	possibly damaging	0.73
R7470:Siglec1	UTSW	2	131075824	missense	probably benign	0.00
R7568:Siglec1	UTSW	2	131072682	missense	probably damaging	1.00
R7781:Siglec1	UTSW	2	131081338	missense	probably damaging	1.00
R7853:Siglec1	UTSW	2	131081292	missense	probably damaging	1.00
R7999:Siglec1	UTSW	2	131071163	missense	probably benign	0.28
R8191:Siglec1	UTSW	2	131085679	missense	probably damaging	1.00
R8274:Siglec1	UTSW	2	131083910	missense	probably benign
R8345:Siglec1	UTSW	2	131078578	missense	possibly damaging	0.95
X0024:Siglec1	UTSW	2	131080491	missense	probably damaging	1.00
Z1176:Siglec1	UTSW	2	131078745	missense	probably damaging	0.99
Z1176:Siglec1	UTSW	2	131080524	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGAGTCTCTGTCAGAACTGCTCTCC -3'
(R):5'- AGTCCACAGGCTTCAAATTTCCCAC -3'

Sequencing Primer
(F):5'- GTCAGAACTGCTCTCCCTATTC -3'
(R):5'- TTCCTTCGCTGGAAAAGGC -3'

Posted On

2013-06-11