Mutagenetix > Incidental Mutations

Incidental Mutation 'R5018:Bfsp1'

458191

Institutional Source

Beutler Lab

Gene Symbol

Bfsp1

Ensembl Gene

ENSMUSG00000027420

Gene Name

beaded filament structural protein 1, in lens-CP94

Synonyms

filensin

MMRRC Submission

042609-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R5018 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

143826528-143863173 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 143862882 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 17 (R17L)

Ref Sequence

ENSEMBL: ENSMUSP00000096899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028907
AA Change: R17L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420
AA Change: R17L

Domain	Start	End	E-Value	Type
Pfam:Filament	34	205	2.5e-13	PFAM
low complexity region	400	411	N/A	INTRINSIC
low complexity region	544	561	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099296
AA Change: R17L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420
AA Change: R17L

Domain	Start	End	E-Value	Type
Filament	32	317	1.05e-6	SMART
low complexity region	406	417	N/A	INTRINSIC
low complexity region	550	567	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	A	T	14: 68,571,779	F245I	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Als2cr12	A	G	1: 58,690,950	V67A	probably benign	Het
Alx4	G	T	2: 93,677,419	G353V	probably damaging	Het
Apol7b	A	G	15: 77,424,716	F61L	probably benign	Het
Aunip	T	A	4: 134,523,617		probably null	Het
Birc6	T	A	17: 74,640,059	D2926E	probably damaging	Het
Dmwd	A	G	7: 19,078,119	D166G	probably damaging	Het
Dnah10	T	C	5: 124,762,196	S1233P	possibly damaging	Het
Dnah11	G	T	12: 118,130,728	N868K	probably benign	Het
Eea1	T	C	10: 96,011,037	V393A	probably benign	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fyttd1	A	G	16: 32,902,417		probably null	Het
Hal	T	C	10: 93,507,551		probably null	Het
Hhat	A	T	1: 192,595,038	L371Q	probably damaging	Het
Hpse2	A	G	19: 43,384,824	F122S	possibly damaging	Het
Kif21b	A	G	1: 136,172,234	I1509V	probably benign	Het
Klhl20	T	C	1: 161,101,586	D334G	probably damaging	Het
Macf1	C	T	4: 123,385,599	D3870N	probably damaging	Het
Nlrc5	C	T	8: 94,525,452	A1867V	probably damaging	Het
Nr1h5	A	G	3: 102,947,795	L330P	probably damaging	Het
Olfr1513	A	C	14: 52,349,279	C256G	possibly damaging	Het
Pcdh15	T	G	10: 74,643,775	S573A	possibly damaging	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Scd4	T	A	19: 44,337,609	M134K	probably benign	Het
Sh3gl2	A	G	4: 85,391,054		probably benign	Het
Sin3a	T	A	9: 57,110,891	S865T	probably benign	Het
Slitrk3	G	A	3: 73,050,512	T309I	probably benign	Het
Sspo	G	A	6: 48,455,700	E837K	probably damaging	Het
Stag1	A	G	9: 100,951,619	D1095G	probably benign	Het
Trat1	A	T	16: 48,734,805	L188*	probably null	Het
Ubn1	A	G	16: 5,063,725	D207G	probably damaging	Het
Ugp2	A	G	11: 21,331,052	Y219H	probably damaging	Het
Ugt2b1	G	T	5: 86,925,962	Y179*	probably null	Het
Vmn2r27	T	A	6: 124,224,182	D272V	probably benign	Het
Vmn2r3	T	C	3: 64,271,353	E497G	probably benign	Het
Vmn2r91	G	T	17: 18,136,438	C789F	probably damaging	Het
Zfp276	A	G	8: 123,264,977		probably benign	Het

Other mutations in Bfsp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Bfsp1	APN	2	143831892	missense	probably damaging	1.00
IGL01457:Bfsp1	APN	2	143827644	splice site	probably benign
IGL02329:Bfsp1	APN	2	143862646	missense	probably benign
IGL02354:Bfsp1	APN	2	143831987	missense	probably damaging	1.00
IGL02361:Bfsp1	APN	2	143831987	missense	probably damaging	1.00
IGL02365:Bfsp1	APN	2	143826736	missense	probably damaging	1.00
IGL02407:Bfsp1	APN	2	143826933	missense	probably benign	0.00
IGL03118:Bfsp1	APN	2	143827333	missense	possibly damaging	0.94
I0000:Bfsp1	UTSW	2	143845968	missense	probably damaging	1.00
R0112:Bfsp1	UTSW	2	143827643	splice site	probably null
R0657:Bfsp1	UTSW	2	143827650	splice site	probably benign
R1642:Bfsp1	UTSW	2	143841763	missense	probably damaging	1.00
R1816:Bfsp1	UTSW	2	143841679	missense	probably benign	0.23
R2061:Bfsp1	UTSW	2	143862678	missense	probably benign	0.08
R2248:Bfsp1	UTSW	2	143827652	splice site	probably null
R3024:Bfsp1	UTSW	2	143845959	missense	probably benign	0.19
R4029:Bfsp1	UTSW	2	143831829	splice site	probably benign
R4914:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4915:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4917:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4918:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R5202:Bfsp1	UTSW	2	143826971	missense	probably benign
R5267:Bfsp1	UTSW	2	143827051	missense	probably benign	0.03
R5304:Bfsp1	UTSW	2	143827291	missense	probably benign	0.34
R5825:Bfsp1	UTSW	2	143827459	missense	probably benign	0.01
R6465:Bfsp1	UTSW	2	143858055	critical splice donor site	probably null
R6888:Bfsp1	UTSW	2	143826719	missense	probably benign	0.31
R7036:Bfsp1	UTSW	2	143826923	missense	possibly damaging	0.65
R7075:Bfsp1	UTSW	2	143848965	missense	probably damaging	1.00
R7362:Bfsp1	UTSW	2	143826875	missense	probably benign	0.19
R7538:Bfsp1	UTSW	2	143831835	critical splice donor site	probably null
R7839:Bfsp1	UTSW	2	143831850	missense	possibly damaging	0.79
X0022:Bfsp1	UTSW	2	143858117	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTACTTGCTGCGGAACTCGTC -3'
(R):5'- TGTATGGGCGGCTTAATCCC -3'

Sequencing Primer
(F):5'- TGCAGATTGGCCTCGACG -3'
(R):5'- GGCTTAATCCCGCACACAAAG -3'

Posted On

2017-02-24