Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:AI464131'

45823

Institutional Source

Beutler Lab

Gene Symbol

AI464131

Ensembl Gene

ENSMUSG00000046312

Gene Name

expressed sequence AI464131

Synonyms

NET37

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41495604-41503076 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41498167 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 488 (R488W)

Ref Sequence

ENSEMBL: ENSMUSP00000059038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054920] [ENSMUST00000149596]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054920
AA Change: R488W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312
AA Change: R488W

Domain	Start	End	E-Value	Type
transmembrane domain	56	78	N/A	INTRINSIC
Pfam:Glyco_hydro_31	311	712	9.7e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149596

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in AI464131

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:AI464131	APN	4	41498923	missense	possibly damaging	0.68
IGL01352:AI464131	APN	4	41499469	nonsense	probably null
IGL01384:AI464131	APN	4	41498151	missense	probably damaging	0.99
IGL02150:AI464131	APN	4	41499183	missense	possibly damaging	0.48
IGL02557:AI464131	APN	4	41497900	missense	possibly damaging	0.51
R0238:AI464131	UTSW	4	41498912	missense	probably benign	0.11
R0238:AI464131	UTSW	4	41498912	missense	probably benign	0.11
R0413:AI464131	UTSW	4	41498585	missense	probably benign	0.00
R0455:AI464131	UTSW	4	41499538	nonsense	probably null
R0511:AI464131	UTSW	4	41498538	missense	probably damaging	0.96
R0785:AI464131	UTSW	4	41497539	missense	probably benign	0.02
R0940:AI464131	UTSW	4	41497996	missense	probably damaging	1.00
R1677:AI464131	UTSW	4	41497947	missense	probably benign	0.00
R1762:AI464131	UTSW	4	41498553	missense	possibly damaging	0.91
R1984:AI464131	UTSW	4	41497501	missense	possibly damaging	0.95
R2192:AI464131	UTSW	4	41497704	missense	probably damaging	0.99
R2496:AI464131	UTSW	4	41499165	missense	probably benign	0.28
R4212:AI464131	UTSW	4	41498307	missense	probably benign	0.01
R4321:AI464131	UTSW	4	41498767	missense	probably benign	0.00
R4672:AI464131	UTSW	4	41499061	missense	probably benign	0.00
R4890:AI464131	UTSW	4	41498877	missense	probably benign	0.00
R4954:AI464131	UTSW	4	41498241	missense	possibly damaging	0.89
R5177:AI464131	UTSW	4	41498407	nonsense	probably null
R5967:AI464131	UTSW	4	41497830	missense	probably benign	0.00
R6005:AI464131	UTSW	4	41498895	missense	probably benign	0.31
R6128:AI464131	UTSW	4	41498445	missense	probably damaging	1.00
R6162:AI464131	UTSW	4	41497899	missense	possibly damaging	0.51
R7202:AI464131	UTSW	4	41498268	missense	probably damaging	0.99
R7211:AI464131	UTSW	4	41498028	missense	probably damaging	1.00
R7311:AI464131	UTSW	4	41498577	missense	probably damaging	1.00
R7524:AI464131	UTSW	4	41498779	missense	probably benign	0.03
R7680:AI464131	UTSW	4	41497978	missense	probably damaging	1.00
R8177:AI464131	UTSW	4	41497568	nonsense	probably null
X0024:AI464131	UTSW	4	41498107	missense	possibly damaging	0.92
Z1088:AI464131	UTSW	4	41497557	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAACGGATAGCCCAGCATACTGAC -3'
(R):5'- GCCCGCCTATGGCGACTTTAATTTC -3'

Sequencing Primer
(F):5'- CCAGCATACTGACGGTGAG -3'
(R):5'- CGACTTTAATTTCGACGAGGGC -3'

Posted On

2013-06-11