Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Bspry'

45824

Institutional Source

Beutler Lab

Gene Symbol

Bspry

Ensembl Gene

ENSMUSG00000028392

Gene Name

B-box and SPRY domain containing

Synonyms

zetin 1

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62480053-62497298 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62486449 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 161 (R161G)

Ref Sequence

ENSEMBL: ENSMUSP00000103073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030088] [ENSMUST00000107449] [ENSMUST00000132237]

AlphaFold

Q80YW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000030088
AA Change: R161G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030088
Gene: ENSMUSG00000028392
AA Change: R161G

Domain	Start	End	E-Value	Type
low complexity region	9	60	N/A	INTRINSIC
Pfam:zf-B_box	65	107	1.2e-8	PFAM
low complexity region	225	239	N/A	INTRINSIC
PRY	277	330	1.79e-15	SMART
Pfam:SPRY	333	451	3.3e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107449
AA Change: R161G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103073
Gene: ENSMUSG00000028392
AA Change: R161G

Domain	Start	End	E-Value	Type
low complexity region	9	60	N/A	INTRINSIC
Pfam:zf-B_box	65	107	4.4e-9	PFAM
low complexity region	225	239	N/A	INTRINSIC
PRY	277	330	1.79e-15	SMART
Pfam:SPRY	331	452	1.1e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132237

SMART Domains

Protein: ENSMUSP00000119504
Gene: ENSMUSG00000028392

Domain	Start	End	E-Value	Type
low complexity region	9	60	N/A	INTRINSIC
Pfam:zf-B_box	65	107	2e-9	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Bspry

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Bspry	APN	4	62496105	missense	probably benign	0.44
IGL02186:Bspry	APN	4	62495989	splice site	probably benign
IGL02501:Bspry	APN	4	62496435	missense	probably benign	0.04
IGL02644:Bspry	APN	4	62496328	missense	probably damaging	1.00
R0041:Bspry	UTSW	4	62486554	missense	probably damaging	1.00
R0306:Bspry	UTSW	4	62496157	missense	probably damaging	1.00
R1919:Bspry	UTSW	4	62494797	missense	probably damaging	1.00
R3038:Bspry	UTSW	4	62496983	missense	probably benign	0.36
R4431:Bspry	UTSW	4	62482667	missense	possibly damaging	0.95
R4690:Bspry	UTSW	4	62486525	missense	probably damaging	0.98
R4735:Bspry	UTSW	4	62486525	missense	probably damaging	0.98
R5432:Bspry	UTSW	4	62482715	missense	probably benign	0.01
R5684:Bspry	UTSW	4	62496282	missense	possibly damaging	0.81
R7209:Bspry	UTSW	4	62486615	missense	possibly damaging	0.86
R7680:Bspry	UTSW	4	62496591	makesense	probably null
R7708:Bspry	UTSW	4	62496100	missense	probably benign	0.36
X0025:Bspry	UTSW	4	62480198	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCCTGACCACTGGGAGTTAGAAG -3'
(R):5'- TCATGTCCACCATGTTGGTGCG -3'

Sequencing Primer
(F):5'- ATGACCTTCTGAGACATGGC -3'
(R):5'- CATGTTGGTGCGGAGGG -3'

Posted On

2013-06-11