Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Vmn2r69'

45830

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r69

Ensembl Gene

ENSMUSG00000091006

Gene Name

vomeronasal 2, receptor 69

Synonyms

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85404849-85417476 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 85409714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132726 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171213]

AlphaFold

G3XA45

Predicted Effect

probably null
Transcript: ENSMUST00000171213

SMART Domains

Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	465	1.3e-28	PFAM
Pfam:NCD3G	507	559	1.8e-20	PFAM
Pfam:7tm_3	592	827	3.2e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207880

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Vmn2r69

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Vmn2r69	APN	7	85406531	missense	probably benign
IGL01457:Vmn2r69	APN	7	85406628	missense	possibly damaging	0.87
IGL01760:Vmn2r69	APN	7	85406864	missense	possibly damaging	0.90
IGL01834:Vmn2r69	APN	7	85412368	missense	probably damaging	1.00
IGL02001:Vmn2r69	APN	7	85407226	missense	probably benign	0.05
IGL02057:Vmn2r69	APN	7	85411782	missense	possibly damaging	0.93
IGL02289:Vmn2r69	APN	7	85406846	missense	probably damaging	1.00
IGL02472:Vmn2r69	APN	7	85409752	missense	probably benign	0.01
IGL02478:Vmn2r69	APN	7	85406681	missense	probably damaging	1.00
IGL02554:Vmn2r69	APN	7	85409806	missense	probably damaging	1.00
IGL02723:Vmn2r69	APN	7	85410208	missense	probably damaging	1.00
R0526:Vmn2r69	UTSW	7	85411503	missense	probably damaging	1.00
R0909:Vmn2r69	UTSW	7	85406665	missense	probably benign	0.00
R0976:Vmn2r69	UTSW	7	85406900	missense	probably damaging	1.00
R1158:Vmn2r69	UTSW	7	85409850	splice site	probably benign
R1459:Vmn2r69	UTSW	7	85406700	nonsense	probably null
R1482:Vmn2r69	UTSW	7	85406874	missense	probably damaging	1.00
R1917:Vmn2r69	UTSW	7	85411683	missense	probably damaging	1.00
R2016:Vmn2r69	UTSW	7	85407285	missense	probably damaging	0.98
R2108:Vmn2r69	UTSW	7	85410196	missense	probably benign
R2571:Vmn2r69	UTSW	7	85415556	missense	probably benign
R2910:Vmn2r69	UTSW	7	85406710	missense	probably damaging	1.00
R2920:Vmn2r69	UTSW	7	85411765	missense	probably benign	0.08
R3708:Vmn2r69	UTSW	7	85411821	missense	probably damaging	0.98
R3710:Vmn2r69	UTSW	7	85406393	missense	probably benign
R4757:Vmn2r69	UTSW	7	85412367	missense	probably damaging	0.99
R4823:Vmn2r69	UTSW	7	85411300	missense	probably benign	0.21
R4870:Vmn2r69	UTSW	7	85411585	missense	possibly damaging	0.93
R4918:Vmn2r69	UTSW	7	85406759	missense	probably benign	0.06
R5022:Vmn2r69	UTSW	7	85411159	missense	possibly damaging	0.72
R5174:Vmn2r69	UTSW	7	85415531	missense	possibly damaging	0.92
R5200:Vmn2r69	UTSW	7	85406509	missense	probably damaging	1.00
R5278:Vmn2r69	UTSW	7	85411783	missense	probably benign	0.02
R5643:Vmn2r69	UTSW	7	85407196	missense	probably damaging	0.98
R5996:Vmn2r69	UTSW	7	85411909	splice site	probably null
R6083:Vmn2r69	UTSW	7	85406503	missense	probably damaging	1.00
R6140:Vmn2r69	UTSW	7	85411449	missense	probably damaging	0.99
R6306:Vmn2r69	UTSW	7	85415591	missense	probably benign	0.04
R6330:Vmn2r69	UTSW	7	85411627	missense	probably benign
R6380:Vmn2r69	UTSW	7	85411859	missense	probably benign
R6466:Vmn2r69	UTSW	7	85407170	missense	probably benign	0.01
R6542:Vmn2r69	UTSW	7	85411205	nonsense	probably null
R6583:Vmn2r69	UTSW	7	85409809	missense	probably benign
R6623:Vmn2r69	UTSW	7	85407101	missense	possibly damaging	0.84
R6709:Vmn2r69	UTSW	7	85411861	missense	probably benign	0.03
R6732:Vmn2r69	UTSW	7	85411143	missense	probably benign	0.00
R6741:Vmn2r69	UTSW	7	85412516	missense	probably benign	0.01
R7070:Vmn2r69	UTSW	7	85411480	missense	probably damaging	0.98
R7234:Vmn2r69	UTSW	7	85407107	missense	probably benign	0.22
R7323:Vmn2r69	UTSW	7	85411764	missense	possibly damaging	0.95
R7427:Vmn2r69	UTSW	7	85411259	missense	probably benign	0.28
R7428:Vmn2r69	UTSW	7	85411259	missense	probably benign	0.28
R7453:Vmn2r69	UTSW	7	85411560	frame shift	probably null
R7532:Vmn2r69	UTSW	7	85410414	missense	probably benign	0.36
R7556:Vmn2r69	UTSW	7	85411560	frame shift	probably null
R7562:Vmn2r69	UTSW	7	85407212	missense	probably benign
R7592:Vmn2r69	UTSW	7	85411560	frame shift	probably null
R7708:Vmn2r69	UTSW	7	85412547	missense	possibly damaging	0.87
R7803:Vmn2r69	UTSW	7	85407116	missense	probably benign	0.00
R7960:Vmn2r69	UTSW	7	85406765	missense	probably benign
R7966:Vmn2r69	UTSW	7	85411554	missense	possibly damaging	0.81
R8071:Vmn2r69	UTSW	7	85406505	nonsense	probably null
R8237:Vmn2r69	UTSW	7	85411132	missense	probably benign	0.02
R8347:Vmn2r69	UTSW	7	85415630	missense	probably benign	0.00
R8737:Vmn2r69	UTSW	7	85406575	missense	probably damaging	1.00
R8795:Vmn2r69	UTSW	7	85415675	start codon destroyed	probably null	0.94
R8831:Vmn2r69	UTSW	7	85409810	nonsense	probably null
R8856:Vmn2r69	UTSW	7	85412455	missense	probably benign	0.00
R8998:Vmn2r69	UTSW	7	85411099	missense	probably benign	0.33
R8999:Vmn2r69	UTSW	7	85411099	missense	probably benign	0.33
R9161:Vmn2r69	UTSW	7	85406969	missense	possibly damaging	0.88
R9228:Vmn2r69	UTSW	7	85415489	missense	probably benign	0.01
Z1176:Vmn2r69	UTSW	7	85406488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGGATCTACAATAGTGAGGCAAA -3'
(R):5'- GCATCTTCCAAGTGGTCAACAGCTATA -3'

Sequencing Primer
(F):5'- CAATAGTGAGGCAAAAATACAGTTC -3'
(R):5'- CAGGAATCTCTGTTGTGGGAATC -3'

Posted On

2013-06-11