Incidental Mutation 'R0560:Slc10a2'
ID45833
Institutional Source Beutler Lab
Gene Symbol Slc10a2
Ensembl Gene ENSMUSG00000023073
Gene Namesolute carrier family 10, member 2
SynonymsASBT
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location5083219-5105351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5089092 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 284 (N284S)
Ref Sequence ENSEMBL: ENSMUSP00000023835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023835]
Predicted Effect probably benign
Transcript: ENSMUST00000023835
AA Change: N284S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023835
Gene: ENSMUSG00000023073
AA Change: N284S

DomainStartEndE-ValueType
Pfam:SBF 39 220 1e-47 PFAM
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/bile acid cotransporter. This transporter is the primary mechanism for uptake of intestinal bile acids by apical cells in the distal ileum. Bile acids are the catabolic product of cholesterol metabolism, so this protein is also critical for cholesterol homeostasis. Mutations in this gene cause primary bile acid malabsorption (PBAM); muatations in this gene may also be associated with other diseases of the liver and intestines, such as familial hypertriglyceridemia (FHTG). [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially indistinguishable from wild-type in terms of survival, gross appearance and behavior. However, they do have defects in lipid absorption from the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Slc10a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc10a2 APN 8 5091668 missense probably damaging 0.96
IGL00504:Slc10a2 APN 8 5091667 missense probably benign 0.00
IGL00596:Slc10a2 APN 8 5091680 missense probably benign 0.00
IGL01472:Slc10a2 APN 8 5091652 missense probably damaging 1.00
IGL02679:Slc10a2 APN 8 5098499 missense probably damaging 1.00
gall UTSW 8 5091621 critical splice donor site probably null
R0629:Slc10a2 UTSW 8 5098562 missense probably benign 0.30
R0743:Slc10a2 UTSW 8 5089132 missense probably damaging 0.99
R0970:Slc10a2 UTSW 8 5105115 missense probably benign 0.00
R1033:Slc10a2 UTSW 8 5104889 missense probably damaging 0.99
R1557:Slc10a2 UTSW 8 5091755 missense probably damaging 1.00
R1808:Slc10a2 UTSW 8 5104856 missense probably damaging 0.96
R3620:Slc10a2 UTSW 8 5104909 missense probably damaging 0.99
R4084:Slc10a2 UTSW 8 5089126 missense possibly damaging 0.71
R4112:Slc10a2 UTSW 8 5105135 missense probably benign
R5693:Slc10a2 UTSW 8 5105128 missense probably damaging 1.00
R6294:Slc10a2 UTSW 8 5091621 critical splice donor site probably null
R6459:Slc10a2 UTSW 8 5098581 splice site probably null
R7442:Slc10a2 UTSW 8 5089086 missense possibly damaging 0.80
Z1177:Slc10a2 UTSW 8 5098448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGTTCCTTGGAAGCATTGAAA -3'
(R):5'- aggggaaggaagaGCAAACAGGTA -3'

Sequencing Primer
(F):5'- CCTCACAGGTTAGTAAGTCTGACTAC -3'
(R):5'- agggaaagaggaaggaaagaaag -3'
Posted On2013-06-11