Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Gm5422'

45836

Institutional Source

Beutler Lab

Gene Symbol

Gm5422

Ensembl Gene

ENSMUSG00000039684

Gene Name

predicted pseudogene 5422

Synonyms

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.787) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31248140-31251045 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

G to A at 31249244 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000050717

SMART Domains

Protein: ENSMUSP00000135967
Gene: ENSMUSG00000039684

Domain	Start	End	E-Value	Type
low complexity region	44	61	N/A	INTRINSIC
Pfam:PC_rep	438	474	6.8e-9	PFAM
Pfam:PC_rep	475	509	1.1e-8	PFAM
SCOP:d1gw5a_	603	760	4e-4	SMART
PDB:4CR4\|Z	648	901	1e-50	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216161

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Gm5422

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01306:Gm5422	APN	10	31249436	exon	noncoding transcript
IGL01569:Gm5422	APN	10	31249901	exon	noncoding transcript
IGL01645:Gm5422	APN	10	31250073	exon	noncoding transcript
IGL02273:Gm5422	APN	10	31250007	exon	noncoding transcript
IGL02603:Gm5422	APN	10	31249440	exon	noncoding transcript
IGL02928:Gm5422	APN	10	31250254	exon	noncoding transcript
IGL03003:Gm5422	APN	10	31250844	exon	noncoding transcript
IGL03274:Gm5422	APN	10	31250352	exon	noncoding transcript
IGL03297:Gm5422	APN	10	31249731	exon	noncoding transcript
ANU23:Gm5422	UTSW	10	31249436	exon	noncoding transcript
R0010:Gm5422	UTSW	10	31249754	exon	noncoding transcript
R0506:Gm5422	UTSW	10	31250322	exon	noncoding transcript
R0573:Gm5422	UTSW	10	31250160	exon	noncoding transcript
R0652:Gm5422	UTSW	10	31249281	exon	noncoding transcript
R1210:Gm5422	UTSW	10	31250723	intron	noncoding transcript
R1259:Gm5422	UTSW	10	31249115	exon	noncoding transcript
R1352:Gm5422	UTSW	10	31250735	intron	noncoding transcript
R1631:Gm5422	UTSW	10	31249806	exon	noncoding transcript
R1707:Gm5422	UTSW	10	31248462	exon	noncoding transcript
R1893:Gm5422	UTSW	10	31249613	exon	noncoding transcript
R2011:Gm5422	UTSW	10	31248768	exon	noncoding transcript
R2132:Gm5422	UTSW	10	31248933	exon	noncoding transcript
R3427:Gm5422	UTSW	10	31248846	exon	noncoding transcript
R3772:Gm5422	UTSW	10	31248514	exon	noncoding transcript
R4703:Gm5422	UTSW	10	31249612	exon	noncoding transcript
R5539:Gm5422	UTSW	10	31248650	exon	noncoding transcript
R5603:Gm5422	UTSW	10	31250844	exon	noncoding transcript
R5660:Gm5422	UTSW	10	31250052	exon	noncoding transcript
R6124:Gm5422	UTSW	10	31249400	exon	noncoding transcript
R6178:Gm5422	UTSW	10	31249692	exon	noncoding transcript
R8263:Gm5422	UTSW	10	31249103	missense	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGTTCCGAAAGTTTAGCCGTTTCCC -3'
(R):5'- ATCATGCCAAGAGACGCAGCAG -3'

Sequencing Primer
(F):5'- TGGCACTGATGCTCAATGAC -3'
(R):5'- GAGACGCAGCAGCACTTAAC -3'

Posted On

2013-06-11