Incidental Mutation 'R0560:Ccdc138'
ID 45837
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Name coiled-coil domain containing 138
Synonyms 6230424H07Rik
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R0560 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 58497948-58576244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58575717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 636 (T636A)
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
AlphaFold Q0VF22
Predicted Effect probably damaging
Transcript: ENSMUST00000036576
AA Change: T636A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010
AA Change: T636A

coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Meta Mutation Damage Score 0.2626 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58575715 missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58529016 splice site probably benign
IGL01012:Ccdc138 APN 10 58540915 critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58528923 missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58562030 missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58544914 splice site probably benign
IGL02652:Ccdc138 APN 10 58513079 missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58528899 splice site probably benign
IGL02934:Ccdc138 APN 10 58573580 splice site probably benign
IGL03231:Ccdc138 APN 10 58573706 missense probably damaging 1.00
R0128:Ccdc138 UTSW 10 58528360 missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58575823 missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58561967 missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58575720 missense probably damaging 1.00
R1405:Ccdc138 UTSW 10 58545117 splice site probably benign
R2032:Ccdc138 UTSW 10 58513162 missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58561937 nonsense probably null
R2350:Ccdc138 UTSW 10 58561893 splice site probably benign
R2571:Ccdc138 UTSW 10 58513222 missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58538270 missense probably damaging 1.00
R3805:Ccdc138 UTSW 10 58561997 missense possibly damaging 0.95
R4582:Ccdc138 UTSW 10 58507643 critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58573655 missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58561996 missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58544995 missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58573636 missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58507572 missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58575705 missense possibly damaging 0.89
R5683:Ccdc138 UTSW 10 58540819 missense probably damaging 1.00
R5963:Ccdc138 UTSW 10 58575757 missense possibly damaging 0.90
R6530:Ccdc138 UTSW 10 58544968 missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58538280 missense probably damaging 1.00
R7217:Ccdc138 UTSW 10 58509600 missense probably benign 0.33
R9031:Ccdc138 UTSW 10 58545071 missense probably damaging 1.00
R9080:Ccdc138 UTSW 10 58562062 missense probably damaging 0.99
R9104:Ccdc138 UTSW 10 58513160 missense probably benign 0.05
R9134:Ccdc138 UTSW 10 58538280 missense probably damaging 0.99
R9300:Ccdc138 UTSW 10 58507626 missense probably benign 0.00
R9409:Ccdc138 UTSW 10 58538313 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acatacatatcacacacacacac -3'
Posted On 2013-06-11