Incidental Mutation 'R0560:Slfn3'
ID 45838
Institutional Source Beutler Lab
Gene Symbol Slfn3
Ensembl Gene ENSMUSG00000018986
Gene Name schlafen 3
Synonyms
MMRRC Submission 038752-MU
Accession Numbers

MGI: 1329005
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0560 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83191330-83215154 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83213152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 283 (F283S)
Ref Sequence ENSEMBL: ENSMUSP00000150425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019130] [ENSMUST00000214041]
AlphaFold A0A1L1STQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000019130
AA Change: F160S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986
AA Change: F160S

DomainStartEndE-ValueType
Pfam:AlbA_2 165 303 5.5e-11 PFAM
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214041
AA Change: F283S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216599
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal immune cell populations. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Slfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slfn3 APN 11 83213431 missense probably damaging 1.00
IGL01405:Slfn3 APN 11 83214716 missense possibly damaging 0.90
IGL01631:Slfn3 APN 11 83213535 missense probably damaging 0.99
IGL01944:Slfn3 APN 11 83213148 missense possibly damaging 0.59
IGL02354:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02361:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02512:Slfn3 APN 11 83213025 missense possibly damaging 0.55
IGL02875:Slfn3 APN 11 83213427 missense probably damaging 0.98
IGL02944:Slfn3 APN 11 83213011 missense probably damaging 0.99
IGL03402:Slfn3 APN 11 83213431 missense probably damaging 1.00
R0452:Slfn3 UTSW 11 83213128 missense possibly damaging 0.87
R0506:Slfn3 UTSW 11 83213160 missense probably damaging 0.99
R0788:Slfn3 UTSW 11 83212836 missense possibly damaging 0.47
R1602:Slfn3 UTSW 11 83212715 missense probably damaging 1.00
R1713:Slfn3 UTSW 11 83213314 missense probably damaging 0.98
R1881:Slfn3 UTSW 11 83213376 missense possibly damaging 0.80
R2264:Slfn3 UTSW 11 83212972 missense probably benign 0.00
R2441:Slfn3 UTSW 11 83212683 missense probably benign 0.00
R2921:Slfn3 UTSW 11 83215045 missense probably benign 0.01
R4163:Slfn3 UTSW 11 83212770 missense probably damaging 1.00
R5099:Slfn3 UTSW 11 83214938 missense probably damaging 0.98
R5448:Slfn3 UTSW 11 83214605 missense probably damaging 0.99
R6441:Slfn3 UTSW 11 83214914 missense probably benign 0.00
R6527:Slfn3 UTSW 11 83213106 missense probably benign 0.01
R6785:Slfn3 UTSW 11 83214601 missense possibly damaging 0.73
R7128:Slfn3 UTSW 11 83214895 missense probably benign 0.00
R7344:Slfn3 UTSW 11 83212822 missense probably benign 0.28
R7528:Slfn3 UTSW 11 83214905 missense probably benign 0.01
R7763:Slfn3 UTSW 11 83214788 missense possibly damaging 0.95
R8155:Slfn3 UTSW 11 83212785 missense probably damaging 1.00
R8178:Slfn3 UTSW 11 83214679 missense probably benign 0.33
R8210:Slfn3 UTSW 11 83214506 missense possibly damaging 0.48
R8347:Slfn3 UTSW 11 83213589 missense possibly damaging 0.95
R8671:Slfn3 UTSW 11 83212999 missense probably benign 0.00
R9093:Slfn3 UTSW 11 83213122 missense probably damaging 0.99
R9106:Slfn3 UTSW 11 83212632 missense probably benign 0.00
R9293:Slfn3 UTSW 11 83214790 missense possibly damaging 0.85
R9362:Slfn3 UTSW 11 83212981 missense probably benign
Z1176:Slfn3 UTSW 11 83213409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTGCAGCTCCTCAAATCC -3'
(R):5'- TCTCCCCACAGAAGTGAGTGACAG -3'

Sequencing Primer
(F):5'- TCCAGGACAGATCCCGAAGAG -3'
(R):5'- TCTCTAGAAGCACGAGATTGCTC -3'
Posted On 2013-06-11