Incidental Mutation 'R0560:Arsb'
ID45841
Institutional Source Beutler Lab
Gene Symbol Arsb
Ensembl Gene ENSMUSG00000042082
Gene Namearylsulfatase B
SynonymsAs-1r, As1-s, Ast-1, As-1s, Asr-1, 1110007C02Rik, As1, As1-r, As1-t, As-1, As-1t
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93771630-93943016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93790198 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000088964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091403
AA Change: T159A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088964
Gene: ENSMUSG00000042082
AA Change: T159A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Sulfatase 46 364 1.7e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220652
Meta Mutation Damage Score 0.4889 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutation of this gene results in development of shortened limbs and snout and a broadened head after 4 weeks of age. Mutant animals have elevated concentrations of glucosaminoglycans in the urine and irregular cartilage structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Arsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Arsb APN 13 93790100 missense probably benign 0.07
IGL00334:Arsb APN 13 93939279 missense probably benign 0.01
IGL01560:Arsb APN 13 93807598 missense probably benign 0.01
IGL02408:Arsb APN 13 93794162 missense probably benign 0.19
IGL03396:Arsb APN 13 93939317 missense probably benign 0.01
dipper UTSW 13 93790066 missense possibly damaging 0.95
ouzel UTSW 13 93794220 critical splice donor site probably null
rivulet UTSW 13 93862327 missense probably damaging 1.00
R0145:Arsb UTSW 13 93862287 missense possibly damaging 0.60
R0379:Arsb UTSW 13 93940627 missense probably benign 0.20
R0488:Arsb UTSW 13 93940505 missense probably benign
R1938:Arsb UTSW 13 93862150 missense probably damaging 1.00
R1968:Arsb UTSW 13 93807559 missense probably benign 0.00
R2209:Arsb UTSW 13 93862101 missense probably benign 0.14
R2224:Arsb UTSW 13 93794171 missense probably damaging 1.00
R2520:Arsb UTSW 13 93940699 nonsense probably null
R4476:Arsb UTSW 13 93807595 missense probably damaging 1.00
R4910:Arsb UTSW 13 93771977 missense probably benign
R5153:Arsb UTSW 13 93940598 missense probably benign 0.20
R5185:Arsb UTSW 13 93794159 missense probably damaging 1.00
R5272:Arsb UTSW 13 93794162 missense possibly damaging 0.86
R5475:Arsb UTSW 13 93862265 missense probably benign 0.00
R5580:Arsb UTSW 13 93807545 missense probably damaging 1.00
R6371:Arsb UTSW 13 93790066 missense possibly damaging 0.95
R6668:Arsb UTSW 13 93794220 critical splice donor site probably null
R7084:Arsb UTSW 13 93940616 missense probably benign 0.00
R7735:Arsb UTSW 13 93771983 missense probably benign 0.00
R7801:Arsb UTSW 13 93862327 missense probably damaging 1.00
R7859:Arsb UTSW 13 93862107 missense probably benign 0.03
X0010:Arsb UTSW 13 93794202 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGGCACTAATCCCCAGTTTTG -3'
(R):5'- AGTCTTCCCCTGGAGAACACAGTC -3'

Sequencing Primer
(F):5'- ACTAATCCCCAGTTTTGTGTTTATC -3'
(R):5'- TCTGGCTAAgccccccc -3'
Posted On2013-06-11