Incidental Mutation 'R0560:Mtrf1'
ID 45844
Institutional Source Beutler Lab
Gene Symbol Mtrf1
Ensembl Gene ENSMUSG00000022022
Gene Name mitochondrial translational release factor 1
Synonyms
MMRRC Submission 038752-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R0560 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79397772-79423587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79406850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 199 (D199E)
Ref Sequence ENSEMBL: ENSMUSP00000022600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600]
AlphaFold Q8K126
Predicted Effect probably damaging
Transcript: ENSMUST00000022600
AA Change: D199E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022
AA Change: D199E

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227610
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Mtrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Mtrf1 APN 14 79423425 missense probably benign 0.10
IGL01478:Mtrf1 APN 14 79402920 splice site probably benign
IGL01866:Mtrf1 APN 14 79401508 missense probably benign
IGL02290:Mtrf1 APN 14 79401811 nonsense probably null
IGL02929:Mtrf1 APN 14 79402833 missense probably benign 0.00
IGL03342:Mtrf1 APN 14 79415980 missense possibly damaging 0.80
IGL03342:Mtrf1 APN 14 79415871 splice site probably benign
IGL03342:Mtrf1 APN 14 79415872 splice site probably null
R0212:Mtrf1 UTSW 14 79419279 missense probably benign 0.02
R0604:Mtrf1 UTSW 14 79415887 missense possibly damaging 0.92
R0669:Mtrf1 UTSW 14 79419268 nonsense probably null
R0981:Mtrf1 UTSW 14 79401590 missense probably benign 0.04
R1837:Mtrf1 UTSW 14 79401833 missense possibly damaging 0.89
R1969:Mtrf1 UTSW 14 79401671 missense probably damaging 1.00
R3883:Mtrf1 UTSW 14 79419267 missense probably damaging 1.00
R4739:Mtrf1 UTSW 14 79413080 missense probably damaging 1.00
R4748:Mtrf1 UTSW 14 79411650 missense probably damaging 1.00
R4780:Mtrf1 UTSW 14 79401688 missense probably benign 0.02
R4965:Mtrf1 UTSW 14 79406587 missense probably benign
R5616:Mtrf1 UTSW 14 79401445 missense possibly damaging 0.68
R6530:Mtrf1 UTSW 14 79402891 missense possibly damaging 0.89
R6776:Mtrf1 UTSW 14 79413081 missense probably damaging 1.00
R7095:Mtrf1 UTSW 14 79423491 frame shift probably null
R7182:Mtrf1 UTSW 14 79423464 missense possibly damaging 0.60
R7254:Mtrf1 UTSW 14 79423491 frame shift probably null
R7871:Mtrf1 UTSW 14 79406938 missense probably benign 0.19
R8249:Mtrf1 UTSW 14 79401479 missense probably benign 0.23
R9593:Mtrf1 UTSW 14 79419224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGGTCAGAGAGCCATGTACTG -3'
(R):5'- TGTAGGACTGTGTTACCCAGCAGAC -3'

Sequencing Primer
(F):5'- GCCATGTACTGTAAAAGAGTTTTGG -3'
(R):5'- gacccatctcgccagcc -3'
Posted On 2013-06-11