Incidental Mutation 'R0560:Dtx3l'
ID 45845
Institutional Source Beutler Lab
Gene Symbol Dtx3l
Ensembl Gene ENSMUSG00000049502
Gene Name deltex 3-like, E3 ubiquitin ligase
Synonyms
MMRRC Submission 038752-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.288) question?
Stock # R0560 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 35926511-35939151 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35932935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 434 (S434P)
Ref Sequence ENSEMBL: ENSMUSP00000110535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081933] [ENSMUST00000114885]
AlphaFold Q3UIR3
Predicted Effect probably damaging
Transcript: ENSMUST00000081933
AA Change: S434P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080601
Gene: ENSMUSG00000049502
AA Change: S434P

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114885
AA Change: S434P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110535
Gene: ENSMUSG00000049502
AA Change: S434P

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Dtx3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Dtx3l APN 16 35931502 missense probably benign 0.10
IGL02255:Dtx3l APN 16 35933336 missense probably benign 0.10
R1123:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1127:Dtx3l UTSW 16 35938757 missense possibly damaging 0.74
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1584:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1690:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1929:Dtx3l UTSW 16 35933689 missense possibly damaging 0.95
R2014:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2015:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2255:Dtx3l UTSW 16 35936579 missense probably benign 0.01
R3023:Dtx3l UTSW 16 35932436 missense probably benign 0.01
R3176:Dtx3l UTSW 16 35932173 missense probably benign 0.29
R5224:Dtx3l UTSW 16 35938793 missense possibly damaging 0.93
R5233:Dtx3l UTSW 16 35933238 missense possibly damaging 0.49
R5375:Dtx3l UTSW 16 35933027 missense probably damaging 1.00
R5884:Dtx3l UTSW 16 35932233 missense probably benign
R6821:Dtx3l UTSW 16 35933060 missense probably damaging 1.00
R6994:Dtx3l UTSW 16 35931372 critical splice donor site probably null
R7242:Dtx3l UTSW 16 35933401 missense possibly damaging 0.76
R7270:Dtx3l UTSW 16 35933657 missense probably damaging 1.00
R7837:Dtx3l UTSW 16 35931526 missense probably damaging 1.00
R7866:Dtx3l UTSW 16 35938750 missense probably benign 0.00
R8053:Dtx3l UTSW 16 35938952 unclassified probably benign
R8337:Dtx3l UTSW 16 35933703 missense probably benign 0.00
R9764:Dtx3l UTSW 16 35932907 missense probably damaging 1.00
Z1176:Dtx3l UTSW 16 35932457 missense probably damaging 1.00
Z1176:Dtx3l UTSW 16 35933183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTAAGGCTGCATTCTCCTGCTG -3'
(R):5'- AATAACCGCATCTGGGTACACGAC -3'

Sequencing Primer
(F):5'- TGGAGACATACTGCATTGCC -3'
(R):5'- TACACGACGGGCATCGAG -3'
Posted On 2013-06-11