Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Dtx3l'

45845

Institutional Source

Beutler Lab

Gene Symbol

Dtx3l

Ensembl Gene

ENSMUSG00000049502

Gene Name

deltex 3-like, E3 ubiquitin ligase

Synonyms

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.340) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35926511-35939151 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35932935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 434 (S434P)

Ref Sequence

ENSEMBL: ENSMUSP00000110535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081933] [ENSMUST00000114885]

AlphaFold

Q3UIR3

Predicted Effect

probably damaging
Transcript: ENSMUST00000081933
AA Change: S434P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080601
Gene: ENSMUSG00000049502
AA Change: S434P

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
RING	569	607	5.82e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114885
AA Change: S434P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110535
Gene: ENSMUSG00000049502
AA Change: S434P

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
RING	569	607	5.82e-6	SMART

Meta Mutation Damage Score

0.1652

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Epb41l3	T	G	17: 69,274,897		probably null	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Dtx3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01814:Dtx3l	APN	16	35931502	missense	probably benign	0.10
IGL02255:Dtx3l	APN	16	35933336	missense	probably benign	0.10
R1123:Dtx3l	UTSW	16	35933268	missense	probably damaging	1.00
R1127:Dtx3l	UTSW	16	35938757	missense	possibly damaging	0.74
R1466:Dtx3l	UTSW	16	35932728	missense	probably damaging	1.00
R1466:Dtx3l	UTSW	16	35932728	missense	probably damaging	1.00
R1584:Dtx3l	UTSW	16	35932728	missense	probably damaging	1.00
R1690:Dtx3l	UTSW	16	35933268	missense	probably damaging	1.00
R1929:Dtx3l	UTSW	16	35933689	missense	possibly damaging	0.95
R2014:Dtx3l	UTSW	16	35936427	missense	probably benign	0.08
R2015:Dtx3l	UTSW	16	35936427	missense	probably benign	0.08
R2255:Dtx3l	UTSW	16	35936579	missense	probably benign	0.01
R3023:Dtx3l	UTSW	16	35932436	missense	probably benign	0.01
R3176:Dtx3l	UTSW	16	35932173	missense	probably benign	0.29
R5224:Dtx3l	UTSW	16	35938793	missense	possibly damaging	0.93
R5233:Dtx3l	UTSW	16	35933238	missense	possibly damaging	0.49
R5375:Dtx3l	UTSW	16	35933027	missense	probably damaging	1.00
R5884:Dtx3l	UTSW	16	35932233	missense	probably benign
R6821:Dtx3l	UTSW	16	35933060	missense	probably damaging	1.00
R6994:Dtx3l	UTSW	16	35931372	critical splice donor site	probably null
R7242:Dtx3l	UTSW	16	35933401	missense	possibly damaging	0.76
R7270:Dtx3l	UTSW	16	35933657	missense	probably damaging	1.00
R7837:Dtx3l	UTSW	16	35931526	missense	probably damaging	1.00
R7866:Dtx3l	UTSW	16	35938750	missense	probably benign	0.00
R8053:Dtx3l	UTSW	16	35938952	unclassified	probably benign
R8337:Dtx3l	UTSW	16	35933703	missense	probably benign	0.00
Z1176:Dtx3l	UTSW	16	35932457	missense	probably damaging	1.00
Z1176:Dtx3l	UTSW	16	35933183	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGTAAGGCTGCATTCTCCTGCTG -3'
(R):5'- AATAACCGCATCTGGGTACACGAC -3'

Sequencing Primer
(F):5'- TGGAGACATACTGCATTGCC -3'
(R):5'- TACACGACGGGCATCGAG -3'

Posted On

2013-06-11