Mutagenetix > Incidental Mutations

Incidental Mutation 'R0560:Epb41l3'

45846

Institutional Source

Beutler Lab

Gene Symbol

Epb41l3

Ensembl Gene

ENSMUSG00000024044

Gene Name

erythrocyte membrane protein band 4.1 like 3

Synonyms

DAL1P, NBL3, Epb4.1l3, 4.1B

MMRRC Submission

038752-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0560 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69075683-69289989 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 69274897 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153228 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080208] [ENSMUST00000112680] [ENSMUST00000225695] [ENSMUST00000225740] [ENSMUST00000225977]

Predicted Effect

probably null
Transcript: ENSMUST00000080208

SMART Domains

Protein: ENSMUSP00000079098
Gene: ENSMUSG00000024044

Domain	Start	End	E-Value	Type
low complexity region	15	40	N/A	INTRINSIC
low complexity region	94	107	N/A	INTRINSIC
B41	114	309	1.13e-80	SMART
FERM_C	313	403	3.96e-38	SMART
FA	405	451	2.34e-17	SMART
low complexity region	497	517	N/A	INTRINSIC
Pfam:SAB	556	604	2.1e-29	PFAM
low complexity region	789	802	N/A	INTRINSIC
Pfam:4_1_CTD	809	922	1.9e-59	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000112680

SMART Domains

Protein: ENSMUSP00000108300
Gene: ENSMUSG00000024044

Domain	Start	End	E-Value	Type
low complexity region	15	40	N/A	INTRINSIC
low complexity region	94	107	N/A	INTRINSIC
B41	114	309	1.13e-80	SMART
FERM_C	313	403	3.96e-38	SMART
FA	405	451	2.34e-17	SMART
low complexity region	497	517	N/A	INTRINSIC
Pfam:SAB	566	614	3.2e-28	PFAM
low complexity region	799	812	N/A	INTRINSIC
Pfam:4_1_CTD	825	931	2.9e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187090

Predicted Effect

probably null
Transcript: ENSMUST00000223703

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223816

Predicted Effect

probably null
Transcript: ENSMUST00000224523

Predicted Effect

probably null
Transcript: ENSMUST00000224951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225316

Predicted Effect

probably null
Transcript: ENSMUST00000225695

Predicted Effect

probably benign
Transcript: ENSMUST00000225740

Predicted Effect

probably null
Transcript: ENSMUST00000225977

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (26/26)

MGI Phenotype

PHENOTYPE: Mice homozygous for one knock-out allele display a normal phenotype. Mice homozygous for a different knock-out allele exhibit ataxia, gait abnormalities, clasping, hypermyelination, abnormal axon morphology, and decreased internode length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,254,498	L230Q	probably damaging	Het
AI464131	G	A	4: 41,498,167	R488W	probably damaging	Het
Apob	T	C	12: 8,005,101	Y1334H	probably damaging	Het
Arsb	A	G	13: 93,790,198	T159A	possibly damaging	Het
Asb18	A	C	1: 90,014,528	V17G	probably damaging	Het
Bicd1	A	G	6: 149,511,962	K284E	probably benign	Het
Bspry	A	G	4: 62,486,449	R161G	probably damaging	Het
Ccdc138	A	G	10: 58,575,717	T636A	probably damaging	Het
Cubn	A	T	2: 13,428,680	W1140R	probably damaging	Het
Cyp2t4	A	G	7: 27,158,511	T479A	probably damaging	Het
Dtx3l	A	G	16: 35,932,935	S434P	probably damaging	Het
Duox2	A	G	2: 122,291,554	V611A	probably benign	Het
Fam161b	C	T	12: 84,357,718	D63N	probably damaging	Het
Gm5422	G	A	10: 31,249,244		noncoding transcript	Het
Gpr158	A	T	2: 21,825,274	D710V	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Mtrf1	T	A	14: 79,406,850	D199E	probably damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Ncf2	T	A	1: 152,821,522	Y47N	probably damaging	Het
Ovgp1	T	C	3: 105,986,410		probably benign	Het
Siglec1	G	T	2: 131,070,346	T1692N	probably benign	Het
Slc10a2	T	C	8: 5,089,092	N284S	probably benign	Het
Slfn3	T	C	11: 83,213,152	F283S	probably damaging	Het
Trank1	T	C	9: 111,391,086	F2297S	possibly damaging	Het
Vmn2r69	A	G	7: 85,409,714		probably null	Het
Vps13d	T	C	4: 145,054,190	E3957G	probably damaging	Het

Other mutations in Epb41l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00975:Epb41l3	APN	17	69207861	splice site	probably benign
IGL01099:Epb41l3	APN	17	69210193	missense	possibly damaging	0.80
IGL01578:Epb41l3	APN	17	69248709	missense	probably damaging	1.00
IGL02269:Epb41l3	APN	17	69247573	missense	probably damaging	1.00
IGL02926:Epb41l3	APN	17	69247746	missense	probably damaging	1.00
IGL03397:Epb41l3	APN	17	69248692	missense	probably damaging	1.00
E0370:Epb41l3	UTSW	17	69274804	missense	possibly damaging	0.73
P0031:Epb41l3	UTSW	17	69259054	nonsense	probably null
R0032:Epb41l3	UTSW	17	69210384	critical splice donor site	probably null
R0056:Epb41l3	UTSW	17	69253397	missense	probably damaging	1.00
R0092:Epb41l3	UTSW	17	69286750	missense	probably damaging	1.00
R0499:Epb41l3	UTSW	17	69247659	missense	probably benign	0.00
R1164:Epb41l3	UTSW	17	69274767	missense	possibly damaging	0.93
R1170:Epb41l3	UTSW	17	69259180	nonsense	probably null
R1397:Epb41l3	UTSW	17	69262348	critical splice donor site	probably null
R2080:Epb41l3	UTSW	17	69253468	missense	possibly damaging	0.54
R2138:Epb41l3	UTSW	17	69207880	missense	probably damaging	1.00
R2279:Epb41l3	UTSW	17	69270650	missense	possibly damaging	0.56
R2863:Epb41l3	UTSW	17	69210321	missense	probably benign	0.22
R3883:Epb41l3	UTSW	17	69274116	nonsense	probably null
R3884:Epb41l3	UTSW	17	69274116	nonsense	probably null
R4165:Epb41l3	UTSW	17	69207888	missense	probably damaging	1.00
R4795:Epb41l3	UTSW	17	69248719	critical splice donor site	probably null
R5286:Epb41l3	UTSW	17	69262273	missense	probably benign	0.00
R5303:Epb41l3	UTSW	17	69257449	missense	probably damaging	1.00
R5373:Epb41l3	UTSW	17	69286800	missense	probably damaging	1.00
R5374:Epb41l3	UTSW	17	69286800	missense	probably damaging	1.00
R5938:Epb41l3	UTSW	17	69259071	missense	probably damaging	1.00
R6014:Epb41l3	UTSW	17	69283960	missense	probably damaging	0.98
R6059:Epb41l3	UTSW	17	69284642	missense	probably damaging	1.00
R6059:Epb41l3	UTSW	17	69286798	missense	probably damaging	1.00
R7318:Epb41l3	UTSW	17	69266140	missense
R7480:Epb41l3	UTSW	17	69261872	splice site	probably null
R7548:Epb41l3	UTSW	17	69210276	missense	probably damaging	1.00
R7719:Epb41l3	UTSW	17	69253414	missense	possibly damaging	0.81
R7769:Epb41l3	UTSW	17	69238426	missense	probably damaging	0.98
R7903:Epb41l3	UTSW	17	69274337	splice site	probably null
R8099:Epb41l3	UTSW	17	69247688	missense	possibly damaging	0.79
R8175:Epb41l3	UTSW	17	69210366	missense	probably damaging	1.00
R8225:Epb41l3	UTSW	17	69274801	missense	possibly damaging	0.52
R8364:Epb41l3	UTSW	17	69266434	critical splice donor site	probably null
R8540:Epb41l3	UTSW	17	69286762	missense	probably damaging	1.00
X0066:Epb41l3	UTSW	17	69259158	nonsense	probably null
Z1088:Epb41l3	UTSW	17	69253522	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGGAAGACTGACTGCTGGACTC -3'
(R):5'- AGGTAAGAACCCAGCCATGTGCTC -3'

Sequencing Primer
(F):5'- TGGACTCTGTCTTACTCTGAATATAG -3'
(R):5'- GCCTGTCATTAGCCCAATTAGAG -3'

Posted On

2013-06-11