Incidental Mutation 'R0561:Chrna1'
ID45853
Institutional Source Beutler Lab
Gene Symbol Chrna1
Ensembl Gene ENSMUSG00000027107
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)
SynonymsAcra, Achr-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73563215-73580338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73566252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 433 (V433A)
Ref Sequence ENSEMBL: ENSMUSP00000028515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028515]
PDB Structure
Crystal structure of the extracellular domain of the nicotinic acetylcholine receptor 1 subunit bound to alpha-bungarotoxin at 1.9 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028515
AA Change: V433A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028515
Gene: ENSMUSG00000027107
AA Change: V433A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 231 1.5e-72 PFAM
Pfam:Neur_chan_memb 238 446 1.1e-67 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an alpha subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The alpha subunit plays a role in substrate binding and channel gating. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, kyphosis, carpotosis, absent miniature and nerve-evoked endplant potential, increased motor neuron number, and abnormal neuromuscular synapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Chrna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Chrna1 APN 2 73570642 missense probably benign
IGL02043:Chrna1 APN 2 73568106 missense probably benign 0.00
IGL02553:Chrna1 APN 2 73566862 missense possibly damaging 0.79
IGL02663:Chrna1 APN 2 73574316 splice site probably benign
IGL02799:Chrna1 APN 2 73574641 splice site probably benign
IGL03369:Chrna1 APN 2 73570445 missense probably benign 0.02
R0113:Chrna1 UTSW 2 73566836 missense possibly damaging 0.88
R0513:Chrna1 UTSW 2 73568082 splice site probably benign
R0540:Chrna1 UTSW 2 73571471 missense probably damaging 1.00
R1922:Chrna1 UTSW 2 73568232 missense probably damaging 1.00
R5303:Chrna1 UTSW 2 73566274 missense probably benign
R5481:Chrna1 UTSW 2 73566926 missense possibly damaging 0.90
R5598:Chrna1 UTSW 2 73566731 missense probably benign 0.01
R5931:Chrna1 UTSW 2 73568100 missense probably benign 0.39
R6153:Chrna1 UTSW 2 73573309 missense probably benign 0.02
R6194:Chrna1 UTSW 2 73570472 missense probably benign 0.17
R6301:Chrna1 UTSW 2 73570484 missense possibly damaging 0.92
R6455:Chrna1 UTSW 2 73566836 missense possibly damaging 0.88
X0026:Chrna1 UTSW 2 73570611 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCAAGAATACAGCCGTGTGAGCAG -3'
(R):5'- ACCATGAAGTCAGACCAGGAGTCC -3'

Sequencing Primer
(F):5'- CGTGTGAGCAGAGATCACTC -3'
(R):5'- gtctgtctgtctgtctatctatctg -3'
Posted On2013-06-11