Incidental Mutation 'R0561:Olfr1196'
ID45854
Institutional Source Beutler Lab
Gene Symbol Olfr1196
Ensembl Gene ENSMUSG00000075120
Gene Nameolfactory receptor 1196
SynonymsMOR225-5, GA_x6K02T2Q125-50181139-50180195
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88697303-88704597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88700570 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 253 (I253T)
Ref Sequence ENSEMBL: ENSMUSP00000149902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104892] [ENSMUST00000216928] [ENSMUST00000216977]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104892
AA Change: I253T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100488
Gene: ENSMUSG00000075120
AA Change: I253T

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 7.2e-47 PFAM
Pfam:7tm_1 39 285 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216928
AA Change: I253T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216977
AA Change: I253T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Olfr1196
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Olfr1196 APN 2 88700966 missense probably damaging 1.00
R0269:Olfr1196 UTSW 2 88700696 missense probably damaging 0.99
R0556:Olfr1196 UTSW 2 88700771 missense possibly damaging 0.83
R0617:Olfr1196 UTSW 2 88700696 missense probably damaging 0.99
R1497:Olfr1196 UTSW 2 88700762 missense probably damaging 1.00
R1676:Olfr1196 UTSW 2 88701317 missense probably benign 0.00
R3979:Olfr1196 UTSW 2 88700448 missense probably benign 0.08
R4791:Olfr1196 UTSW 2 88700898 missense probably benign 0.00
R4836:Olfr1196 UTSW 2 88701200 missense probably damaging 1.00
R5917:Olfr1196 UTSW 2 88700705 missense possibly damaging 0.94
R6232:Olfr1196 UTSW 2 88700817 missense probably benign 0.21
R6392:Olfr1196 UTSW 2 88700667 missense probably damaging 1.00
R7033:Olfr1196 UTSW 2 88700820 missense probably damaging 1.00
R7360:Olfr1196 UTSW 2 88700987 missense probably damaging 1.00
R7640:Olfr1196 UTSW 2 88700886 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAACTCTGAGTGACAGCCGAGAC -3'
(R):5'- GCTATGTTGCCATTGTCAAGCCCC -3'

Sequencing Primer
(F):5'- CGAGACCACACCTTGTGC -3'
(R):5'- ATTGTCACGGCCTGGATAC -3'
Posted On2013-06-11