Incidental Mutation 'R0561:Or4c11'
ID 45855
Institutional Source Beutler Lab
Gene Symbol Or4c11
Ensembl Gene ENSMUSG00000062757
Gene Name olfactory receptor family 4 subfamily C member 11
Synonyms GA_x6K02T2Q125-50339974-50340609, Olfr1207, Olfr1206, MOR230-3, GA_x6K02T2Q125-50338497-50339264
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0561 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88694951-88695874 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88695024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 25 (V25E)
Ref Sequence ENSEMBL: ENSMUSP00000149929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077302] [ENSMUST00000216950]
AlphaFold A2ATJ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000077302
AA Change: V25E

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076532
Gene: ENSMUSG00000062757
AA Change: V25E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216950
AA Change: V25E

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,335,204 (GRCm39) D30G possibly damaging Het
Apc A T 18: 34,446,356 (GRCm39) H1050L possibly damaging Het
Armc2 A G 10: 41,869,188 (GRCm39) V166A probably benign Het
Atp6v1b1 A T 6: 83,730,793 (GRCm39) I173F probably damaging Het
Bpifb4 A G 2: 153,786,742 (GRCm39) D298G probably damaging Het
C4b T A 17: 34,953,391 (GRCm39) S1031C probably damaging Het
Calcr A G 6: 3,692,630 (GRCm39) I408T probably damaging Het
Catsperg1 T C 7: 28,881,737 (GRCm39) N1009S probably damaging Het
Ces2a T C 8: 105,464,165 (GRCm39) S266P probably benign Het
Chrna1 A G 2: 73,396,596 (GRCm39) V433A possibly damaging Het
Ctnnb1 G A 9: 120,780,788 (GRCm39) V291M probably damaging Het
Dcbld1 T C 10: 52,138,032 (GRCm39) Y99H probably benign Het
Ddx60 A T 8: 62,470,828 (GRCm39) H1440L possibly damaging Het
Dsg1c A T 18: 20,407,832 (GRCm39) I393L probably benign Het
Eif5 G T 12: 111,506,950 (GRCm39) R128L probably benign Het
Ercc3 A G 18: 32,378,592 (GRCm39) D191G possibly damaging Het
Gp1ba A T 11: 70,530,416 (GRCm39) probably benign Het
Krt24 C T 11: 99,175,439 (GRCm39) E199K probably damaging Het
Lrif1 G T 3: 106,639,481 (GRCm39) A164S probably damaging Het
Map2 A G 1: 66,464,656 (GRCm39) D1682G probably damaging Het
Megf8 C T 7: 25,028,257 (GRCm39) P274S probably benign Het
Mslnl C T 17: 25,962,177 (GRCm39) Q192* probably null Het
Nfkb2 T C 19: 46,298,301 (GRCm39) V535A possibly damaging Het
Or10q1 A T 19: 13,726,662 (GRCm39) Y64F probably damaging Het
Or4a66 A G 2: 88,530,914 (GRCm39) I253T possibly damaging Het
Or7a37 T A 10: 78,805,729 (GRCm39) L82* probably null Het
Or8b37 G T 9: 37,959,123 (GRCm39) V202L probably benign Het
Or8g22 C T 9: 38,958,669 (GRCm39) M15I probably damaging Het
Pag1 T A 3: 9,764,481 (GRCm39) Y224F probably damaging Het
Pbrm1 A C 14: 30,757,948 (GRCm39) I193L probably benign Het
Phrf1 T C 7: 140,834,876 (GRCm39) V17A probably benign Het
Plekhg2 T G 7: 28,069,908 (GRCm39) T42P probably benign Het
Pmp22 T A 11: 63,025,250 (GRCm39) W28R probably damaging Het
Ppp1r13b A T 12: 111,832,880 (GRCm39) H82Q probably damaging Het
Rgs8 T C 1: 153,541,668 (GRCm39) probably null Het
Rtl1 A G 12: 109,560,363 (GRCm39) V492A probably damaging Het
Slc22a27 A G 19: 7,857,527 (GRCm39) probably null Het
Slx4ip A G 2: 136,908,090 (GRCm39) E79G probably null Het
Syde1 C T 10: 78,425,210 (GRCm39) R267H probably damaging Het
Tas2r114 A G 6: 131,666,758 (GRCm39) I90T probably benign Het
Tjp3 C T 10: 81,109,674 (GRCm39) G843D probably benign Het
Tln1 A T 4: 43,550,304 (GRCm39) M453K possibly damaging Het
Ttc39a A T 4: 109,297,799 (GRCm39) Y408F probably damaging Het
Usp39 T G 6: 72,313,368 (GRCm39) Q274P probably damaging Het
Uvrag C T 7: 98,537,768 (GRCm39) V476I probably damaging Het
Vcan T A 13: 89,860,372 (GRCm39) T332S probably damaging Het
Vcan T A 13: 89,879,583 (GRCm39) H22L possibly damaging Het
Wls A G 3: 159,578,705 (GRCm39) D89G probably benign Het
Zfhx2 A T 14: 55,303,346 (GRCm39) V1546E probably benign Het
Zfp457 T A 13: 67,442,134 (GRCm39) H147L probably damaging Het
Other mutations in Or4c11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Or4c11 APN 2 88,695,864 (GRCm39) missense probably benign 0.00
IGL01415:Or4c11 APN 2 88,695,864 (GRCm39) missense probably benign 0.00
IGL01783:Or4c11 APN 2 88,695,186 (GRCm39) missense probably damaging 0.98
PIT4812001:Or4c11 UTSW 2 88,695,314 (GRCm39) missense probably benign 0.27
R0437:Or4c11 UTSW 2 88,695,229 (GRCm39) missense probably benign 0.01
R0669:Or4c11 UTSW 2 88,695,272 (GRCm39) missense probably benign
R0835:Or4c11 UTSW 2 88,695,345 (GRCm39) missense probably benign
R0987:Or4c11 UTSW 2 88,695,527 (GRCm39) missense probably benign 0.00
R1271:Or4c11 UTSW 2 88,695,475 (GRCm39) nonsense probably null
R1386:Or4c11 UTSW 2 88,695,697 (GRCm39) missense probably benign 0.14
R1618:Or4c11 UTSW 2 88,695,871 (GRCm39) splice site probably null
R1935:Or4c11 UTSW 2 88,695,524 (GRCm39) missense probably benign
R2098:Or4c11 UTSW 2 88,695,215 (GRCm39) missense probably benign 0.43
R2112:Or4c11 UTSW 2 88,695,545 (GRCm39) missense possibly damaging 0.67
R2157:Or4c11 UTSW 2 88,695,213 (GRCm39) missense probably benign
R2912:Or4c11 UTSW 2 88,695,458 (GRCm39) missense probably benign 0.17
R2913:Or4c11 UTSW 2 88,695,458 (GRCm39) missense probably benign 0.17
R4583:Or4c11 UTSW 2 88,695,838 (GRCm39) missense probably benign 0.07
R4631:Or4c11 UTSW 2 88,695,174 (GRCm39) missense probably benign 0.00
R7707:Or4c11 UTSW 2 88,695,153 (GRCm39) missense possibly damaging 0.78
R8559:Or4c11 UTSW 2 88,695,527 (GRCm39) missense probably benign 0.00
R9163:Or4c11 UTSW 2 88,695,795 (GRCm39) missense possibly damaging 0.63
R9164:Or4c11 UTSW 2 88,695,795 (GRCm39) missense possibly damaging 0.63
R9468:Or4c11 UTSW 2 88,695,795 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AAGCAGACATGGGTATTCTTCAACGATT -3'
(R):5'- GAGAGGGCATCCACAATGAGTCTTG -3'

Sequencing Primer
(F):5'- GACACGTTTTGTTCAGAAAGTTACC -3'
(R):5'- GGGGCTGTGGATGTTGAAAAG -3'
Posted On 2013-06-11