Incidental Mutation 'Z1088:Oog3'
Institutional Source Beutler Lab
Gene Symbol Oog3
Ensembl Gene ENSMUSG00000050810
Gene Nameoogenesin 3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #Z1088 ()
Quality Score209
Status Not validated
Chromosomal Location144157557-144162663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144159636 bp
Amino Acid Change Phenylalanine to Leucine at position 131 (F131L)
Ref Sequence ENSEMBL: ENSMUSP00000059834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050933]
Predicted Effect probably benign
Transcript: ENSMUST00000050933
AA Change: F131L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059834
Gene: ENSMUSG00000050810
AA Change: F131L

low complexity region 13 26 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
SCOP:d1a4ya_ 226 428 7e-5 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.2%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 1505 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik T C 6: 32,058,492 W36R probably damaging Het
1700016H13Rik G A 5: 103,649,568 P25L probably damaging Het
1700017N19Rik A T 10: 100,605,639 K170M probably damaging Het
1700020A23Rik C T 2: 130,405,852 P77L probably damaging Het
1700020L24Rik A G 11: 83,440,506 Q81R probably damaging Het
2210408I21Rik A C 13: 77,174,891 D13A probably damaging Het
2310003L06Rik G T 5: 87,972,306 Q307H probably damaging Het
2410141K09Rik A C 13: 66,431,186 C413G probably damaging Het
2410141K09Rik C T 13: 66,431,741 G228S probably benign Het
2510039O18Rik G A 4: 147,944,745 E391K probably benign Het
4833423E24Rik T G 2: 85,484,181 K476T probably damaging Het
4833423E24Rik C A 2: 85,502,077 S201I probably benign Het
4930415L06Rik T G X: 89,930,236 D785A unknown Het
4930415L06Rik C A X: 89,930,237 D785Y unknown Het
4930447C04Rik G C 12: 72,939,395 probably benign Het
4931440F15Rik C G 11: 29,825,007 G150A probably damaging Het
4932438A13Rik A C 3: 36,987,567 E2698A probably damaging Het
4932438H23Rik T A 16: 91,055,813 H145L probably benign Het
4933405L10Rik G A 8: 105,709,763 G197E probably damaging Het
5430419D17Rik T C 7: 131,246,633 C839R probably damaging Het
9130011E15Rik T C 19: 45,818,905 E684G probably damaging Het
9430007A20Rik C A 4: 144,528,669 L220M probably damaging Het
A4gnt C T 9: 99,613,841 S110L probably damaging Het
A530099J19Rik C T 13: 19,729,209 noncoding transcript Het
Aasdh T C 5: 76,901,157 probably null Het
Abca13 A C 11: 9,294,687 Q2183H probably damaging Het
Abca14 T A 7: 120,216,135 I202N probably benign Het
Abca17 T A 17: 24,279,079 K1428M probably damaging Het
Abca17 G T 17: 24,279,107 P1419T probably benign Het
Abca17 C G 17: 24,346,219 A80P probably damaging Het
Abca8b A T 11: 109,976,482 M250K probably benign Het
Abcc1 C A 16: 14,410,809 H307N probably benign Het
Abcc12 G A 8: 86,560,279 probably null Het
Abcc8 A G 7: 46,138,065 F571L probably benign Het
Abhd8 G A 8: 71,461,801 P61L probably benign Het
Acan G T 7: 79,088,200 E218* probably null Het
Acan G C 7: 79,100,110 S1543T probably benign Het
Acan A C 7: 79,111,354 H1938P probably benign Het
Accsl A C 2: 93,865,948 F106V probably benign Het
Acnat1 T G 4: 49,447,588 K313T probably damaging Het
Acot8 T C 2: 164,799,813 Q133R probably damaging Het
Acox3 A T 5: 35,588,222 K18M probably damaging Het
Acoxl A C 2: 127,872,195 D137A probably damaging Het
Acsm5 A T 7: 119,537,211 K335M probably damaging Het
Actn4 A C 7: 28,894,578 F855V probably damaging Het
Acvr2a T C 2: 48,870,373 V47A probably benign Het
Ada C G 2: 163,728,116 probably null Het
Adam21 G A 12: 81,560,686 H101Y probably damaging Het
Adam26a T A 8: 43,569,698 N252Y probably damaging Het
Adam26b T C 8: 43,520,597 E456G probably damaging Het
Adam3 C A 8: 24,681,431 probably benign Het
Adamts14 A G 10: 61,218,445 F603L probably damaging Het
Adamts18 T C 8: 113,775,440 K263R possibly damaging Het
Adamts3 G A 5: 89,684,449 R932C probably damaging Het
Adamtsl3 T G 7: 82,499,714 F319V probably damaging Het
Adamtsl3 T C 7: 82,540,325 S586P probably damaging Het
Adcy1 G C 11: 7,150,019 A710P probably benign Het
Adcy4 G A 14: 55,780,956 A178V probably benign Het
Add1 T A 5: 34,613,400 L285* probably null Het
Add2 G C 6: 86,085,965 R35P probably damaging Het
Adgrb3 C T 1: 25,131,271 R982H probably damaging Het
Adgrf3 T G 5: 30,199,120 K378T possibly damaging Het
Adgrl3 C A 5: 81,329,882 H61N probably benign Het
Adgrl3 A T 5: 81,512,158 D258V probably damaging Het
Adgrl4 C A 3: 151,500,175 P175T probably benign Het
Adgrv1 G A 13: 81,476,672 P3726L probably damaging Het
Adra1a T G 14: 66,727,496 F312V probably damaging Het
Aebp1 C T 11: 5,871,460 R620* probably null Het
Afdn G A 17: 13,883,780 S1126N probably damaging Het
Afg3l1 A C 8: 123,488,242 E216D possibly damaging Het
Afp G C 5: 90,505,015 G448A possibly damaging Het
Agap2 G T 10: 127,088,242 S775I unknown Het
Agbl1 T G 7: 76,419,904 F143V probably benign Het
Ahnak A T 19: 9,016,082 N4910I probably damaging Het
AI413582 G A 17: 27,564,241 R51C possibly damaging Het
AI464131 A C 4: 41,497,557 L691R probably benign Het
Ak1 A T 2: 32,630,271 K27M probably damaging Het
Aldh1b1 G C 4: 45,802,539 A26P probably benign Het
Aldh1b1 C T 4: 45,802,540 A26V probably benign Het
Alk C G 17: 72,205,807 G386R probably damaging Het
Amn C T 12: 111,275,683 A368V probably benign Het
Amotl2 TCC TC 9: 102,723,698 probably null Het
Ampd3 T G 7: 110,777,825 L8V probably damaging Het
Anapc2 G T 2: 25,273,368 G206* probably null Het
Angel2 G A 1: 190,937,554 D144N probably damaging Het
Angptl3 A G 4: 99,034,520 N266S probably benign Het
Ank2 A G 3: 127,029,509 V397A possibly damaging Het
Ankib1 T A 5: 3,713,136 E531V probably damaging Het
Ankib1 C A 5: 3,713,137 E531* probably null Het
Ankrd16 CCTCCGGTACTT C 2: 11,779,818 probably null Het
Ankrd24 G A 10: 81,638,656 G74D probably damaging Het
Ankrd44 A C 1: 54,658,982 L606R probably damaging Het
Ankrd50 T G 3: 38,457,165 K351T probably damaging Het
Anks4b G A 7: 120,182,519 D258N probably benign Het
Anln T C 9: 22,362,801 E580G probably benign Het
Ano3 G A 2: 110,745,847 L454F probably damaging Het
Antxrl A T 14: 34,067,971 N340I probably damaging Het
Anxa10 C T 8: 62,092,506 G64D probably damaging Het
Aox1 G A 1: 58,081,542 V865M probably benign Het
Ap3d1 T C 10: 80,719,237 Y418C possibly damaging Het
Ap5b1 A C 19: 5,570,424 K624T possibly damaging Het
Apbb1 C T 7: 105,559,136 C654Y probably damaging Het
Apbb2 T G 5: 66,302,696 K710T probably damaging Het
Apc C T 18: 34,313,167 Q1021* probably null Het
Apcdd1 T G 18: 62,937,183 F174V probably benign Het
Apob C A 12: 8,005,074 L1358I possibly damaging Het
Apob A T 12: 8,005,945 K1476* probably null Het
Apob A G 12: 8,012,936 N193S possibly damaging Het
Apobr G A 7: 126,585,031 R7H probably benign Het
Apol11b A C 15: 77,638,007 I30R probably benign Het
Arfgef2 A T 2: 166,893,595 T1727S possibly damaging Het
Arfip2 G C 7: 105,637,242 L188V probably damaging Het
Arhgap11a A G 2: 113,842,894 C115R probably damaging Het
Arhgap18 A T 10: 26,850,004 probably null Het
Arhgap26 G C 18: 39,357,671 probably benign Het
Arhgap28 G A 17: 67,861,277 A465V possibly damaging Het
Arhgdib C A 6: 136,933,618 K48N probably damaging Het
Arhgef10 C G 8: 14,964,191 A364G probably benign Het
Arhgef10l G C 4: 140,581,735 L17V possibly damaging Het
Arhgef18 C T 8: 3,439,628 S320F probably damaging Het
Arhgef28 G A 13: 97,945,691 R1203W probably damaging Het
Arl5b G A 2: 15,075,021 M134I probably benign Het
Armc1 C A 3: 19,149,507 S85I probably damaging Het
Armc12 A G 17: 28,532,059 E83G probably benign Het
Armc4 G A 18: 7,266,919 S394L probably benign Het
Armh1 C T 4: 117,213,795 D378N probably benign Het
Arsj G T 3: 126,439,132 R509M possibly damaging Het
Arvcf G A 16: 18,402,641 R602H probably damaging Het
Asb14 A G 14: 26,903,348 K220R probably benign Het
Ascc2 C G 11: 4,646,656 A59G probably benign Het
Asf1b G C 8: 83,969,152 A141P possibly damaging Het
Ash1l C A 3: 88,982,709 L632I probably benign Het
Asph T A 4: 9,630,715 N211I possibly damaging Het
Astn1 C A 1: 158,472,497 P136T possibly damaging Het
Astn1 G A 1: 158,597,206 R646H possibly damaging Het
Astn1 C A 1: 158,684,096 Y1169* probably null Het
Asxl3 A C 18: 22,516,772 K606T probably benign Het
Atf7 C G 15: 102,547,182 G249A probably benign Het
Atg14 C G 14: 47,568,292 A39P probably damaging Het
Atg7 T A 6: 114,695,686 F205I probably benign Het
Atm T G 9: 53,531,687 K92T probably damaging Het
Atp11b G T 3: 35,812,213 G387V probably damaging Het
Atp12a G A 14: 56,386,141 V879I probably benign Het
Atp13a5 T G 16: 29,282,062 K681N probably benign Het
Atp2b2 A C 6: 113,842,306 F9V probably damaging Het
Atp6v1h A C 1: 5,098,048 K147T probably damaging Het
Atp8a2 T G 14: 60,027,970 S306R probably benign Het
Atp8b2 T C 3: 89,954,568 K226R probably damaging Het
Atr A G 9: 95,885,320 probably null Het
Atrn G A 2: 130,973,399 S745N probably benign Het
Auts2 T G 5: 131,476,554 probably benign Het
Avpr1a G C 10: 122,449,577 S258T probably benign Het
AW551984 C A 9: 39,590,603 E736* probably null Het
B3galt6 C A 4: 155,991,934 R228L probably benign Het
B3gnt3 G A 8: 71,693,765 S40F possibly damaging Het
B3gnt8 C T 7: 25,628,150 R2C probably damaging Het
Barx2 G A 9: 31,846,866 P259S possibly damaging Het
Baz2b T A 2: 59,960,015 E618V probably damaging Het
BC016579 C T 16: 45,653,948 D32N probably benign Het
BC051665 T G 13: 60,784,643 E76A probably benign Het
Bcl9 G T 3: 97,210,641 Q246K possibly damaging Het
Best3 C T 10: 117,024,170 S445L probably benign Het
Bfar C T 16: 13,697,460 P304L probably damaging Het
Birc6 A C 17: 74,611,542 E1932D probably damaging Het
Bod1l C G 5: 41,808,764 V2653L possibly damaging Het
Bod1l C T 5: 41,821,146 E942K probably damaging Het
Bptf A C 11: 107,074,582 V1147G probably benign Het
Braf A G 6: 39,662,026 C264R probably damaging Het
Brca2 A T 5: 150,542,763 K1997N probably damaging Het
Brf2 T G 8: 27,123,991 E389A probably damaging Het
Brinp2 G A 1: 158,246,989 R521* probably null Het
Brsk1 C T 7: 4,707,372 T460M possibly damaging Het
Brwd3 A T X: 108,774,860 V732E probably damaging Het
Btaf1 T A 19: 36,986,618 V863D probably damaging Het
Btbd11 C T 10: 85,387,857 H177Y probably benign Het
C1rl C A 6: 124,508,742 D357E probably benign Het
C77080 C T 4: 129,222,298 A903T probably damaging Het
Cacna1b T A 2: 24,661,844 K1096M probably damaging Het
Cacna1b T A 2: 24,733,945 S208C probably damaging Het
Cacna1f C G X: 7,610,251 L144V probably damaging Het
Cacna2d1 A C 5: 16,194,763 E121D probably benign Het
Cacna2d3 G T 14: 29,064,308 A574D probably damaging Het
Cadps C A 14: 12,467,113 D935Y probably damaging Het
Camk2a T G 18: 60,943,150 probably benign Het
Capn15 C T 17: 25,963,347 E530K probably damaging Het
Carmil1 G A 13: 24,044,182 Q600* probably null Het
Carmil3 C T 14: 55,501,568 T893M probably damaging Het
Casp12 C T 9: 5,354,582 A317V possibly damaging Het
Casp9 T G 4: 141,805,461 L223V probably benign Het
Casz1 T C 4: 148,944,359 L1087P probably benign Het
Catsper3 T G 13: 55,808,104 F328V probably damaging Het
Cavin1 T C 11: 100,958,658 D382G probably damaging Het
Ccdc116 C A 16: 17,147,171 probably benign Het
Ccdc130 G A 8: 84,258,909 R244* probably null Het
Ccdc14 G A 16: 34,690,804 M1I probably null Het
Ccdc141 T G 2: 77,128,272 E161D probably benign Het
Ccdc175 G T 12: 72,128,379 H507N probably benign Het
Ccdc24 C T 4: 117,871,063 probably null Het
Ccdc83 T C 7: 90,244,046 K168E probably damaging Het
Ccdc87 A G 19: 4,840,722 K414R probably benign Het
Ccr1l1 T G 9: 123,977,850 I187L probably benign Het
Cd209a G T 8: 3,747,017 S80Y probably damaging Het
Cd2ap G A 17: 42,807,993 T518I probably benign Het
Cd300lb A C 11: 114,926,034 L61V probably damaging Het
Cd36 T A 5: 17,795,575 probably null Het
Cd40 A T 2: 165,063,040 K92M probably damaging Het
Cd48 A T 1: 171,695,727 D46V possibly damaging Het
Cd55 T G 1: 130,452,479 D254A probably benign Het
Cd59b G C 2: 104,081,003 S23T possibly damaging Het
Cd8a T C 6: 71,373,686 L45P possibly damaging Het
Cd93 T A 2: 148,442,364 D354V probably benign Het
Cd99l2 G T X: 71,441,088 P63Q probably damaging Het
Cd99l2 C T X: 71,441,146 probably null Het
Cdan1 T C 2: 120,730,336 S251G probably damaging Het
Cdca2 G C 14: 67,700,298 T302S probably benign Het
Cdca7l A G 12: 117,872,411 M206V possibly damaging Het
Cdh22 T C 2: 165,112,430 S724G probably benign Het
Cdh23 T C 10: 60,413,644 T832A probably benign Het
Cdh7 C G 1: 110,085,123 I395M probably benign Het
Cdh8 G T 8: 99,279,502 S151Y probably damaging Het
Cdk11b G T 4: 155,641,564 probably benign Het
Cdkal1 G C 13: 29,777,236 H117D probably damaging Het
Cdr1 T G X: 61,184,104 E485D possibly damaging Het
Celf4 G C 18: 25,496,249 P406A probably benign Het
Celf5 C T 10: 81,466,949 A301T probably damaging Het
Celsr2 T A 3: 108,414,117 S460C probably damaging Het
Cenpf A C 1: 189,652,931 L2384R probably damaging Het
Cenpp T C 13: 49,647,658 probably null Het
Ces1a T G 8: 93,025,607 K374T probably benign Het
Ces1b T C 8: 93,064,966 E335G probably damaging Het
Ces1d T C 8: 93,175,108 K411R probably benign Het
Ces1e T C 8: 93,210,418 T342A probably benign Het
Ces2e A C 8: 104,931,347 K359T probably benign Het
Ces2e A G 8: 104,932,398 probably null Het
Cfap44 G T 16: 44,401,466 R14I probably damaging Het
Cfap46 C T 7: 139,635,064 G1582R probably damaging Het
Cfap57 C T 4: 118,581,882 D816N probably benign Het
Cfap61 C T 2: 146,129,227 P919L probably benign Het
Cfh A G 1: 140,108,904 L636P probably benign Het
Cfh G A 1: 140,147,718 P243S possibly damaging Het
Chd6 T C 2: 160,966,488 D1602G probably damaging Het
Chil1 A G 1: 134,189,500 K345R probably benign Het
Chrd T C 16: 20,741,255 F891L probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cilp2 C G 8: 69,885,410 K190N possibly damaging Het
Cit A T 5: 115,985,533 S1421C possibly damaging Het
Clca3a1 T G 3: 144,746,953 S590R probably damaging Het
Clcn1 C A 6: 42,300,360 L462I probably benign Het
Clcn1 A C 6: 42,307,256 K514T probably damaging Het
Cldn4 G A 5: 134,946,598 L50F probably damaging Het
Clec4g A C 8: 3,707,796 probably benign Het
Clec4g T G 8: 3,716,548 N251T probably damaging Het
Clu A C 14: 65,976,913 E278D probably benign Het
Cmya5 C G 13: 93,063,579 A3414P probably benign Het
CN725425 T G 15: 91,245,762 F276C possibly damaging Het
Cnksr2 T G X: 157,853,220 N854T probably benign Het
Cnot7 ATTTATTTTTTA ATTTA 8: 40,500,739 probably benign Het
Cnst G C 1: 179,579,565 G59A probably damaging Het
Cntn3 A G 6: 102,420,294 L106P possibly damaging Het
Cntnap4 C G 8: 112,815,520 P762A probably damaging Het
Cntnap5a G A 1: 116,060,251 A171T probably benign Het
Col17a1 A G 19: 47,652,178 S994P possibly damaging Het
Col19a1 A C 1: 24,279,940 I1023S probably damaging Het
Col4a1 T G 8: 11,246,859 probably benign Het
Col4a4 A C 1: 82,453,196 L1662V unknown Het
Col6a1 C G 10: 76,709,559 *1026Y probably null Het
Col6a5 A C 9: 105,926,067 I1233S unknown Het
Col7a1 C T 9: 108,978,500 silent Het
Colec12 A G 18: 9,848,727 T302A probably benign Het
Commd4 T C 9: 57,156,256 S73G probably benign Het
Coro1c A G 5: 113,850,649 probably null Het
Cpd C A 11: 76,801,746 C755F probably damaging Het
Cpsf6 T C 10: 117,356,041 D518G unknown Het
Creb3l4 C T 3: 90,237,751 V365M possibly damaging Het
Crhr2 A G 6: 55,103,216 V126A possibly damaging Het
Crim1 G T 17: 78,367,835 K824N probably benign Het
Crispld1 A G 1: 17,764,076 T489A probably benign Het
Crybg1 C T 10: 43,997,311 R1267H probably benign Het
Cryzl2 G T 1: 157,465,789 L153F probably benign Het
Csgalnact1 T C 8: 68,401,330 K273R probably damaging Het
Csmd1 G T 8: 15,921,875 T2985N possibly damaging Het
Csmd1 C T 8: 16,092,258 D1544N probably damaging Het
Csmd1 T G 8: 16,189,978 K1140T possibly damaging Het
Csmd1 G T 8: 16,200,058 Q969K probably damaging Het
Csmd1 T C 8: 16,346,617 D433G probably damaging Het
Csmd3 G A 15: 47,636,393 L3027F probably damaging Het
Csmd3 G A 15: 47,847,281 P1637S probably damaging Het
Csn2 T G 5: 87,696,009 probably benign Het
Cspg4 C A 9: 56,886,036 L352M probably damaging Het
Cspp1 C G 1: 10,083,546 D393E possibly damaging Het
Ctcfl G A 2: 173,118,344 H149Y probably benign Het
Ctnna3 C T 10: 63,581,978 S165F probably benign Het
Ctnnd2 A C 15: 30,966,813 N970T probably benign Het
Ctr9 T C 7: 111,030,224 L19P probably damaging Het
Ctsd C T 7: 142,376,597 G403S probably damaging Het
Cubn G A 2: 13,294,229 S3211L probably benign Het
Cul3 A G 1: 80,290,091 V177A probably benign Het
Cxcl16 C T 11: 70,455,978 G113E probably damaging Het
Cyfip1 A C 7: 55,875,052 K144T probably damaging Het
Cyp2a12 A G 7: 27,035,420 K422R possibly damaging Het
Cyp2a5 G T 7: 26,841,107 D69Y probably damaging Het
Cyp2b23 C G 7: 26,681,411 A130P probably benign Het
Cyp2c50 C T 19: 40,097,955 A321V possibly damaging Homo
Cyp2c68 C T 19: 39,739,463 A82T probably damaging Het
Cyp2d11 C A 15: 82,390,111 M356I probably damaging Het
Cyp2r1 C T 7: 114,551,974 R370K probably damaging Het
Cyp2t4 G C 7: 27,157,746 G345R probably damaging Het
Cyp3a59 A C 5: 146,098,222 N237H probably benign Het
Cyp4a29 T G 4: 115,248,496 F132V probably benign Het
Cyp4f15 G C 17: 32,692,690 probably null Het
Cyp4f40 G A 17: 32,674,002 probably null Het
D030056L22Rik A T 19: 18,717,315 S145C possibly damaging Het
D230025D16Rik C T 8: 105,231,172 R37C probably damaging Het
D7Ertd443e T G 7: 134,294,982 S154R probably benign Het
Dab1 A C 4: 104,479,232 Q8H probably damaging Het
Dag1 G C 9: 108,208,668 P425A possibly damaging Het
Dapk2 T C 9: 66,246,477 F172L possibly damaging Het
Daw1 A T 1: 83,205,964 K245M probably null Het
Dbnl A T 11: 5,796,797 K176* probably null Het
Dcaf13 C T 15: 39,145,247 R415C probably damaging Het
Dcaf15 A C 8: 84,102,781 W111G probably damaging Het
Dclk1 G T 3: 55,500,105 G235V probably damaging Het
Dclre1c G T 2: 3,438,080 E92D possibly damaging Het
Dda1 C G 8: 71,474,495 A4G probably damaging Het
Ddb1 C A 19: 10,619,230 L438I probably damaging Het
Ddit4l G C 3: 137,626,362 G163A probably benign Het
Ddn T C 15: 98,806,139 E424G possibly damaging Het
Ddx19b T G 8: 111,015,575 K176T probably benign Het
Ddx23 A G 15: 98,647,621 V602A probably benign Het
Ddx59 A C 1: 136,432,451 N401T possibly damaging Het
Def8 A G 8: 123,456,498 R279G probably damaging Het
Defb14 G T 8: 19,195,184 G59V probably damaging Het
Defb8 A C 8: 19,447,541 L18R possibly damaging Het
Defb9 A C 8: 21,881,867 F43L probably benign Het
Dennd1a A G 2: 37,800,692 S799P probably benign Het
Dennd2d C T 3: 106,499,874 R414* probably null Het
Dennd4a G A 9: 64,872,022 A596T probably damaging Het
Dennd5a T G 7: 109,894,747 D1250A possibly damaging Het
Dennd5a T C 7: 109,905,273 K854E probably damaging Het
Dera T G 6: 137,837,118 I99M possibly damaging Het
Desi2 A G 1: 178,187,944 N10S probably benign Het
Dgkg T G 16: 22,469,328 N763T probably damaging Het
Dgkg A T 16: 22,572,686 S341T probably benign Het
Dhh T C 15: 98,894,909 N157D probably benign Het
Dhtkd1 C A 2: 5,911,874 A664S possibly damaging Het
Dhx37 T C 5: 125,416,591 E968G possibly damaging Het
Dhx57 A C 17: 80,251,348 L1061V probably damaging Het
Dip2a T C 10: 76,285,628 K798R probably benign Het
Disp3 G C 4: 148,271,743 A220G possibly damaging Het
Dlg4 G A 11: 70,031,130 R66Q probably damaging Het
Dlg5 G A 14: 24,158,094 P992S probably damaging Het
Dlgap2 C G 8: 14,822,472 A651G probably benign Het
Dlx5 C A 6: 6,879,607 Q153H probably damaging Het
Dmd C T X: 83,878,495 S1457F possibly damaging Het
Dmd A G X: 84,575,760 T2614A probably benign Het
Dmrt2 T G 19: 25,678,642 L535R probably damaging Het
Dmxl1 A G 18: 49,920,965 N2546S probably benign Het
Dnaaf3 G A 7: 4,523,795 R428W probably damaging Het
Dnah1 T G 14: 31,304,811 K752T probably benign Het
Dnah11 G C 12: 117,895,012 T4121R probably damaging Het
Dnah11 C A 12: 117,982,969 A3127S probably damaging Het
Dnah2 A C 11: 69,430,793 L3847R probably damaging Het
Dnah3 T A 7: 120,086,297 D164V probably benign Het
Dnah3 T C 7: 120,010,873 K1769R probably null Het
Dnah5 G A 15: 28,366,357 G2739S probably null Het
Dnah5 A C 15: 28,384,230 D3040A probably damaging Het
Dnah7a A C 1: 53,468,643 Y3090D probably damaging Het
Dnajb12 C A 10: 59,890,054 P54T probably benign Het
Dnajb8 G A 6: 88,222,845 G121D probably benign Het
Dnajc6 G A 4: 101,639,329 V830M probably damaging Het
Dnhd1 C G 7: 105,712,727 T3664S probably benign Het
Dnmbp G A 19: 43,874,984 A453V probably benign Het
Dnmbp G A 19: 43,902,122 P402L probably benign Het
Dock1 A G 7: 134,804,547 Y760C probably damaging Het
Dock10 T C 1: 80,532,347 K1588R probably damaging Het
Dock11 A G X: 36,002,533 K718R probably benign Het
Dock2 G A 11: 34,438,300 T211M probably benign Het
Dock2 A C 11: 34,692,382 L568R probably damaging Het
Dock2 C A 11: 34,695,212 E548* probably null Het
Dock9 C T 14: 121,555,275 V1844M probably damaging Het
Dopey2 C T 16: 93,763,326 T720I probably benign Het
Dpf2 A C 19: 5,902,444 F289V probably damaging Het
Dpy19l2 C T 9: 24,660,824 probably null Het
Dsc2 C T 18: 20,046,304 E236K probably damaging Het
Dscam A C 16: 96,772,561 F734V probably benign Het
Dscc1 A C 15: 55,080,317 S386A possibly damaging Het
Dusp27 A G 1: 166,099,283 L920P probably damaging Het
Dync1h1 GAAA GAA 12: 110,629,917 probably null Het
Dyrk3 A G 1: 131,129,233 L401P probably damaging Het
Ecm1 T C 3: 95,734,876 I466V probably benign Het
Eef2 G C 10: 81,181,889 G795A probably damaging Het
Efcab6 A C 15: 83,955,009 L383R probably damaging Het
Efl1 A C 7: 82,692,850 S489R probably benign Het
Egfl8 C A 17: 34,614,241 G177V probably damaging Het
Ehbp1l1 G C 19: 5,716,287 P399A possibly damaging Het
Ehd2 G C 7: 15,963,466 A139G possibly damaging Het
Eif3j1 T G 2: 122,050,613 F182C probably damaging Het
Eif3k T C 7: 28,974,599 probably null Het
Eif3m A C 2: 105,013,256 L127R probably damaging Het
Elac1 T G 18: 73,739,090 D278A probably benign Het
Ell2 TCTAGGTGGCC TC 13: 75,761,873 probably benign Het
Elmod1 A C 9: 53,919,614 S263A probably benign Het
Eme2 T A 17: 24,894,567 probably null Het
Eml1 T G 12: 108,537,459 F772V possibly damaging Het
Emsy G A 7: 98,600,722 P786L probably damaging Het
Epb41l3 T G 17: 69,253,522 F355V probably damaging Het
Epg5 C G 18: 77,959,139 A591G probably benign Het
Epha4 A C 1: 77,506,662 S237A possibly damaging Het
Epha5 G C 5: 84,237,522 H317D probably benign Het
Ephb1 C T 9: 101,984,145 V607I probably damaging Het
Ephx2 A G 14: 66,107,318 F168L probably benign Het
Eps15l1 T G 8: 72,386,901 N249T probably damaging Het
Ercc6l2 A G 13: 63,853,728 E567G possibly damaging Het
Ermp1 G C 19: 29,612,925 S792R probably damaging Het
Esp8 A G 17: 40,530,045 T66A possibly damaging Het
Esr1 C G 10: 4,712,667 A95G possibly damaging Het
Esrrg A T 1: 188,150,218 E224V probably benign Het
Etaa1 T C 11: 17,946,465 T551A possibly damaging Het
Etv5 C T 16: 22,383,589 E472K probably benign Het
Exoc3l4 G A 12: 111,429,487 D645N probably benign Het
Eya4 T C 10: 23,113,988 Q513R probably damaging Het
F11 C T 8: 45,245,772 G445D possibly damaging Het
F13a1 C T 13: 36,989,012 W131* probably null Het
F13b A C 1: 139,508,202 S249R probably benign Het
F5 A C 1: 164,154,385 K73T probably benign Het
F8 C T X: 75,323,149 probably null Het
Fam117a C G 11: 95,371,524 H151Q possibly damaging Het
Fam186a T C 15: 99,945,994 S790G unknown Het
Fam193a A T 5: 34,420,895 E244D probably benign Het
Fam207a C A 10: 77,490,031 S168I probably damaging Het
Fam71b G A 11: 46,407,723 R618K possibly damaging Het
Fancd2 C G 6: 113,581,422 H1167D probably benign Het
Far2 A C 6: 148,138,658 K29T probably damaging Het
Fat1 A G 8: 45,023,807 I1963M possibly damaging Het
Fat4 C G 3: 38,887,050 L31V possibly damaging Het
Fat4 C G 3: 38,958,492 A2312G probably benign Het
Fbln2 G A 6: 91,233,346 D91N probably damaging Het
Fbn1 C T 2: 125,350,288 D1434N probably damaging Het
Fbxo16 A T 14: 65,293,860 K71M possibly damaging Het
Fbxw21 T C 9: 109,145,537 H305R probably benign Het
Fgd4 T A 16: 16,484,470 K74* probably null Het
Fgfr2 A T 7: 130,169,799 L596H probably damaging Het
Fhl1 T A X: 56,779,491 L10Q probably null Het
Fig4 A C 10: 41,253,731 F498V probably damaging Het
Fign A C 2: 64,096,902 S6R probably benign Het
Filip1l G C 16: 57,513,405 S187T probably damaging Het
Fitm2 C T 2: 163,469,865 E143K probably benign Het
Flnb A C 14: 7,905,871 K1207T probably benign Het
Flnc G A 6: 29,457,151 A2351T probably damaging Het
Flt1 T C 5: 147,681,649 T261A possibly damaging Het
Flt3 C G 5: 147,349,564 probably null Het
Fmn1 A C 2: 113,441,925 probably benign Het
Fmo9 A G 1: 166,673,545 probably null Het
Fn1 A G 1: 71,649,292 I151T probably damaging Het
Fndc1 T G 17: 7,782,479 E139A probably damaging Het
Fndc3b G C 3: 27,465,808 C561W possibly damaging Het
Fndc7 T C 3: 108,883,500 E70G probably damaging Het
Folh1 T G 7: 86,725,954 K575T probably benign Het
Foxc2 G C 8: 121,116,959 W115C possibly damaging Het
Foxc2 G C 8: 121,117,150 R179P probably damaging Het
Foxl1 G A 8: 121,128,772 E271K possibly damaging Het
Foxred2 C T 15: 77,952,003 A385T probably damaging Het
Fpr-rs4 T C 17: 18,021,919 S63P possibly damaging Het
Fpr-rs4 G A 17: 18,022,694 R321K probably benign Het
Fras1 A C 5: 96,743,211 Q2866H probably damaging Het
Fras1 T C 5: 96,758,142 L3135P probably benign Het
Frem1 C T 4: 82,972,267 E974K probably damaging Het
Frem3 A C 8: 80,615,426 Q1449H probably benign Het
Frmd6 A G 12: 70,880,678 Q144R probably benign Het
Frmd7 T G X: 50,896,147 N382T possibly damaging Het
Frmpd1 C T 4: 45,284,080 P967L possibly damaging Het
Frmpd4 G A X: 167,497,840 T348M probably damaging Het
Fryl A C 5: 73,090,709 L1022V probably damaging Het
Fryl A C 5: 73,090,738 L1012R probably damaging Het
Fsd1 T A 17: 55,991,203 L176H probably damaging Het
Fsip2 G C 2: 82,975,448 E704Q probably damaging Het
Fsip2 A C 2: 82,987,653 S4577R possibly damaging Het
Fsip2 A C 2: 82,988,634 K4904Q possibly damaging Het
Fyb G A 15: 6,658,540 V794I probably benign Het
Fzd10 T C 5: 128,601,246 L10P probably damaging Het
Fzd7 G C 1: 59,483,870 G304A probably damaging Het
Gadl1 A T 9: 115,937,270 I37L probably benign Het
Gal3st1 C G 11: 3,997,984 P64A probably benign Het
Gal3st2c A G 1: 94,008,145 H73R probably benign Het
Galnt10 G A 11: 57,721,331 G66R possibly damaging Het
Gbp2 G A 3: 142,630,015 D159N probably benign Het
Gbp4 A T 5: 105,120,997 F430Y probably damaging Het
Gbp9 C A 5: 105,094,125 G189W probably damaging Het
Gclc G A 9: 77,781,367 probably null Het
Gcm2 C A 13: 41,102,792 G494W probably damaging Het
Gcnt2 C A 13: 40,918,639 P253T probably damaging Het
Gdf10 C T 14: 33,932,390 R285C probably damaging Het
Gdpd4 A G 7: 97,966,309 S114G probably damaging Het
Gga1 C A 15: 78,892,021 D421E probably damaging Het
Ggt5 T G 10: 75,608,759 F304V possibly damaging Het
Gja3 A C 14: 57,035,815 L367V possibly damaging Het
Gje1 A C 10: 14,718,124 F9V possibly damaging Het
Glrb T G 3: 80,845,234 K407N possibly damaging Het
Glyat A G 19: 12,648,009 T32A probably benign Het
Gm10324 A G 13: 66,122,394 K458R probably damaging Het
Gm10772 C A 13: 66,227,356 S73I probably benign Het
Gm10784 T G 13: 49,945,143 noncoding transcript Het
Gm1110 A C 9: 26,913,310 L145V probably benign Het
Gm11559 C A 11: 99,864,949 C141* probably null Het
Gm11639 A C 11: 104,751,902 K1117T probably damaging Het
Gm12800 A C 4: 101,910,186 I211L probably benign Het
Gm12800 A G 4: 101,909,118 probably null Het
Gm13078 T C 4: 143,727,033 L237P probably damaging Het
Gm13083 C A 4: 143,615,232 A77E possibly damaging Het
Gm13089 T G 4: 143,698,080 Q264H probably benign Het
Gm13101 C T 4: 143,965,562 E290K probably benign Het
Gm13741 A T 2: 87,656,421 S167T probably damaging Het
Gm13741 A C 2: 87,656,877 L15V probably benign Het
Gm15127 A G X: 148,695,496 T415A probably benign Het
Gm156 T C 6: 129,772,463 probably null Het
Gm15932 G C 14: 55,575,840 probably benign Het
Gm1818 C A 12: 48,556,124 noncoding transcript Het
Gm19965 T G 1: 116,804,600 F58V probably benign Het
Gm2016 A C 12: 87,876,934 E117A possibly damaging Het
Gm20939 T C 17: 94,877,433 F503S probably damaging Het
Gm21834 T G 17: 57,742,121 E33D possibly damaging Het
Gm266 C G 12: 111,485,172 G200A probably damaging Het
Gm266 T C 12: 111,485,337 E145G probably damaging Het
Gm364 A C X: 57,488,638 I668L probably benign Het
Gm4775 C G 14: 106,100,965 noncoding transcript Het
Gm4788 T A 1: 139,754,261 Q199L probably damaging Het
Gm4884 A G 7: 41,042,876 N90D possibly damaging Het
Gm4981 T G 10: 58,235,911 E160D probably damaging Het
Gm5114 T C 7: 39,408,447 K583E probably damaging Het
Gm5152 T C 5: 10,243,130 probably benign Het
Gm5565 G A 5: 146,158,669 T172I probably benign Het
Gm6205 C A 5: 94,683,833 A233E probably benign Het
Gm7173 C A X: 79,330,813 L2544F probably damaging Het
Gm7173 A T X: 79,330,814 L2544* probably null Het
Gm8267 T C 14: 44,724,865 K33E probably benign Het
Gm8674 C A 13: 49,900,794 noncoding transcript Het
Gm8674 T C 13: 49,901,248 noncoding transcript Het
Gm904 A C 13: 50,645,262 K86Q probably damaging Het
Gm9637 A G 14: 19,401,731 noncoding transcript Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gm9774 A G 3: 92,429,090 S102P probably damaging Het
Gm9805 A G 17: 22,689,871 Y34C probably benign Het
Gm9964 T C 11: 79,296,408 E71G unknown Het
Gnal G A 18: 67,191,403 D210N probably damaging Het
Gnas A G 2: 174,298,373 S112G probably benign Het
Gnat3 A C 5: 18,015,323 S228R probably damaging Het
Golgb1 A C 16: 36,919,742 E2814D probably damaging Het
Gorab C G 1: 163,386,323 S346T possibly damaging Het
Gorab C A 1: 163,403,550 E12* probably null Het
Gpaa1 A G 15: 76,332,542 E142G possibly damaging Het
Gpatch8 T A 11: 102,480,945 K589I unknown Het
Gphb5 A C 12: 75,415,807 L3V unknown Het
Gpr26 AC A 7: 131,984,094 probably null Het
Gpr75 T G 11: 30,891,139 L15V probably benign Het
Gprasp1 G T X: 135,799,441 A128S possibly damaging Het
Gpsm2 T C 3: 108,700,760 E234G probably damaging Het
Grid1 G A 14: 35,452,294 R631H probably damaging Het
Grm3 A C 5: 9,570,183 F354V probably damaging Het
Grpel1 C T 5: 36,470,614 R80C probably damaging Het
Gsdmd T G 15: 75,863,474 D22E probably benign Het
Gtf2f2 C T 14: 75,897,623 G221S probably damaging Het
Guca1a T C 17: 47,400,410 I4V probably benign Het
Gucy2c G A 6: 136,743,981 P406L probably benign Het
Gykl1 T A 18: 52,694,165 Y148* probably null Het
H2-T22 G A 17: 36,041,638 R132W probably benign Het
Hao2 A C 3: 98,875,352 V340G probably damaging Het
Hapln1 A G 13: 89,601,498 H54R probably benign Het
Haus6 A C 4: 86,602,874 L176V possibly damaging Het
Hc T G 2: 35,008,249 T1145P possibly damaging Het
Hc T A 2: 35,029,470 D668V probably benign Het
Hccs C G X: 169,313,612 R199T probably damaging Het
Hdac9 T G 12: 34,407,789 K255T probably damaging Het
Hdlbp G A 1: 93,431,354 probably benign Het
Heatr5a G A 12: 51,891,404 A1497V probably damaging Het
Heatr5a T C 12: 51,951,076 T347A probably benign Het
Hectd4 A T 5: 121,295,503 probably null Het
Heph T A X: 96,466,031 V130D probably damaging Het
Hephl1 A T 9: 15,053,721 L1126H probably damaging Het
Herc2 G A 7: 56,131,292 G1235D probably benign Het
Herc2 T G 7: 56,215,381 V4202G possibly damaging Het
Herc2 C A 7: 56,215,432 A4219D probably damaging Het
Herc2 G T 7: 56,226,589 C4450F probably damaging Het
Herc2 G A 7: 56,087,341 A183T probably benign Het
Heyl GGAAGAAG GGAAG 4: 123,240,181 probably benign Het
Hgf C T 5: 16,618,919 R705C probably damaging Het
Hip1r A T 5: 123,999,132 probably null Het
Hipk1 T C 3: 103,764,544 E413G possibly damaging Het
Hipk3 G A 2: 104,434,629 S702F probably damaging Het
Hmcn1 G T 1: 150,648,937 A3414D probably damaging Het
Hmcn2 G T 2: 31,381,067 E1252D probably benign Het
Hmcn2 C A 2: 31,459,064 probably null Het
Hmg20b C G 10: 81,346,573 A310P probably damaging Het
Hnrnpab T G 11: 51,601,746 probably benign Het
Hoxa6 G C 6: 52,206,545 F173L possibly damaging Het
Hoxc4 A T 15: 103,034,763 D14V probably damaging Het
Hpdl G C 4: 116,820,833 P144A probably damaging Het
Hsd3b6 T G 3: 98,806,332 K217T probably benign Het
Hsf2 A T 10: 57,496,168 K72N probably damaging Het
Hsf3 G T X: 96,320,316 S193* probably null Het
Hsf3 A T X: 96,320,317 S250T possibly damaging Het
Hspa13 C T 16: 75,758,185 G338S probably benign Het
Hspa4l C G 3: 40,766,993 S282* probably null Het
Hydin A G 8: 110,299,973 K108E probably benign Het
Hydin G T 8: 110,586,048 K4140N probably benign Het
Hydin AGGG AGG 8: 110,592,791 probably null Het
I830077J02Rik C A 3: 105,927,213 A42S probably damaging Het
Iars G A 13: 49,721,088 S746N probably benign Het
Ifi203 A T 1: 173,928,581 probably benign Het
Ifi206 T G 1: 173,474,011 E700D probably damaging Het
Ifi209 A C 1: 173,637,407 K34N probably damaging Het
Ifi209 A G 1: 173,641,146 K181E probably benign Het
Ifi211 A T 1: 173,907,660 F68I possibly damaging Het
Ifna16 C A 4: 88,676,378 S160I probably damaging Het
Ift52 A C 2: 163,023,358 D43A possibly damaging Het
Ighv13-2 G T 12: 114,357,815 Y82* probably null Het
Ighv1-37 A T 12: 114,896,624 probably benign Het
Ighv15-2 T G 12: 114,564,804 D43A probably damaging Het
Ighv1-69 A C 12: 115,623,253 S87A probably benign Het
Ighv5-9-1 C G 12: 113,736,120 C124S probably damaging Het
Ighv7-4 A C 12: 114,222,897 V85G probably damaging Het
Igkv12-98 C A 6: 68,571,031 T48N probably benign Het
Igkv18-36 C A 6: 69,992,499 V104F probably damaging Het
Igkv2-112 G A 6: 68,220,647 S101N possibly damaging Het
Igkv5-48 C A 6: 69,726,691 G77W probably damaging Het
Igsf10 C T 3: 59,329,938 V941I possibly damaging Het
Ik C T 18: 36,744,782 R4* probably null Het
Il11 G A 7: 4,775,999 S44F probably damaging Het
Il18r1 A C 1: 40,474,751 K39T probably damaging Het
Il18r1 C A 1: 40,478,486 S136Y probably damaging Het
Il3ra G A 14: 14,351,129 R217Q probably benign Het
Inpp4b G A 8: 82,068,931 probably null Het
Inpp5f C G 7: 128,694,949 T381R probably benign Het
Insm2 C G 12: 55,599,797 P109A probably damaging Het
Ints11 G A 4: 155,886,970 D292N probably benign Het
Ipo13 T C 4: 117,904,680 E441G probably benign Het
Iqub C T 6: 24,500,243 probably null Het
Itga2 G A 13: 114,857,332 P762S possibly damaging Het
Itga7 T A 10: 128,949,163 I787N probably benign Het
Itgb1 T G 8: 128,713,369 F180V probably damaging Het
Itgb6 C T 2: 60,620,211 R628Q probably null Het
Itk A C 11: 46,353,862 probably null Het
Itpr3 C T 17: 27,113,528 S1782L possibly damaging Het
Itsn2 A C 12: 4,712,472 S1578R probably damaging Het
Izumo3 C T 4: 92,146,933 A16T probably damaging Het
Jag1 C A 2: 137,085,151 W896L probably benign Het
Jakmip1 A T 5: 37,120,986 I536F probably damaging Het
Jmjd1c T C 10: 67,238,174 L1896P probably benign Het
Jmy T A 13: 93,441,081 S860C probably damaging Het
Jph2 G C 2: 163,397,332 S65R possibly damaging Het
Jrk T C 15: 74,707,394 K14R unknown Het
Kat6a C T 8: 22,935,501 R1021* probably null Het
Kbtbd11 C G 8: 15,027,839 P146R probably damaging Het
Kcna3 C A 3: 107,036,953 F177L probably damaging Het
Kcna7 T G 7: 45,406,959 F200V probably benign Het
Kcna7 A T 7: 45,409,105 K272M probably damaging Het
Kcnb1 G C 2: 167,188,061 A188G probably benign Het
Kcnb2 A C 1: 15,710,091 I396L probably benign Het
Kcnb2 C T 1: 15,711,028 S708L probably benign Het
Kcnh5 C T 12: 74,897,761 A905T probably benign Het
Kcnh5 A C 12: 74,965,295 F617V possibly damaging Het
Kcnh6 T G 11: 106,009,048 F48V probably damaging Het
Kcnh7 A C 2: 62,736,103 L828R probably damaging Het
Kcnh7 G A 2: 63,184,068 R4C probably damaging Het
Kcnh8 G C 17: 52,725,890 K68N probably damaging Het
Kcnh8 A G 17: 52,978,292 S1097G probably benign Het
Kcnj15 A G 16: 95,296,119 K200R probably damaging Het
Kcnk9 T A 15: 72,546,015 T89S possibly damaging Het
Kcnn3 A T 3: 89,667,130 S650C probably damaging Het
Kcnq5 G A 1: 21,457,529 P440L probably damaging Het
Kcnt2 G T 1: 140,573,646 D917Y probably damaging Het
Kcnt2 G A 1: 140,584,158 W1017* probably null Het
Kctd19 A C 8: 105,385,335 L826R probably benign Het
Kctd2 A G 11: 115,421,987 E115G possibly damaging Het
Khdrbs2 T C 1: 32,244,055 probably benign Het
Khsrp C T 17: 57,024,249 R443Q probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif18b T G 11: 102,908,157 K739N probably benign Het
Kif20b G C 19: 34,950,451 E1038Q probably damaging Het
Kif24 C A 4: 41,395,091 S594I probably damaging Het
Kif27 T G 13: 58,288,033 Q1315H probably benign Het
Klhl22 T G 16: 17,776,543 F179V possibly damaging Het
Klhl26 T G 8: 70,451,799 E426A probably damaging Het
Klhl41 A C 2: 69,674,730 K459T possibly damaging Het
Klk1b1 A C 7: 43,970,401 K128T probably benign Het
Klk1b26 A T 7: 44,015,996 Q109H probably benign Het
Klk1b3 G A 7: 44,200,305 W38* probably null Het
Klk6 T C 7: 43,828,488 S95P probably benign Het
Klk9 G A 7: 43,794,311 G83D probably damaging Het
Klra2 A C 6: 131,228,290 L196R probably damaging Het
Kmt2b G T 7: 30,585,251 Q739K probably benign Het
Kprp G A 3: 92,825,057 Q229* probably null Het
Kptn T C 7: 16,123,070 L161P probably damaging Het
Kri1 C A 9: 21,274,122 E639D probably benign Het
Krt32 C T 11: 100,088,216 S4N probably benign Het
Krt36 A T 11: 100,104,189 L186M possibly damaging Het
Krt75 C G 15: 101,573,665 G56A probably benign Het
Krt76 A G 15: 101,890,551 L233P probably damaging Het
Krt78 C T 15: 101,947,331 E682K possibly damaging Het
Krtap6-3 G A 16: 89,084,165 C28Y unknown Het
Ksr1 G C 11: 79,044,879 probably null Het
Ksr2 A C 5: 117,747,402 T764P probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lama1 G A 17: 67,771,082 G1171S probably benign Het
Lama1 G T 17: 67,810,171 G2487V probably damaging Het
Large1 C T 8: 72,912,103 W282* probably null Het
Lce1e A G 3: 92,707,849 C64R unknown Het
Lce1f T C 3: 92,719,254 K32R unknown Het
Lce1i C A 3: 92,777,289 probably null Het
Lefty2 A T 1: 180,897,715 R337W probably damaging Het
Lelp1 T A 3: 92,135,598 K48M unknown Het
Lenep C G 3: 89,402,569 G24A probably damaging Het
Lgr6 C T 1: 134,988,071 G313E possibly damaging Het
Lhb A C 7: 45,421,730 probably null Het
Lipo2 T C 19: 33,721,685 Y315C probably damaging Het
Lmbr1 C A 5: 29,323,816 A110S probably damaging Het
Lmtk2 A G 5: 144,182,851 S1377G probably benign Het
Lpcat2b C T 5: 107,433,311 P169S probably damaging Het
Lpin3 T C 2: 160,892,231 F12S probably damaging Het
Lrfn3 A C 7: 30,360,201 F200V probably damaging Het
Lrif1 G A 3: 106,732,570 D324N probably benign Het
Lrp1 G A 10: 127,584,379 R912C probably damaging Het
Lrp10 A C 14: 54,467,922 T190P probably benign Het
Lrpprc G A 17: 84,731,784 Q923* probably null Het
Lrpprc C T 17: 84,770,500 probably null Het
Lrrc18 C T 14: 33,008,510 A2V probably damaging Het
Lrrc28 T G 7: 67,529,631 K329T possibly damaging Het
Lrrc30 T C 17: 67,631,695 K297E possibly damaging Het
Lrrc32 G A 7: 98,499,060 R349K probably benign Het
Lrrc45 G T 11: 120,720,231 V572F probably damaging Het
Lrrc52 C A 1: 167,466,494 G74V possibly damaging Het
Lrrc63 C T 14: 75,125,990 E234K possibly damaging Het
Lrrfip1 GAAGAACAAGAA GAAGAA 1: 91,115,530 probably benign Het
Lrriq1 T A 10: 103,202,446 N832I probably damaging Het
Lrrk2 T G 15: 91,726,240 V725G probably benign Het
Ltbp4 C T 7: 27,307,792 A1364T probably damaging Het
Luc7l T G 17: 26,267,255 L136R probably damaging Het
Luc7l2 A C 6: 38,603,369 probably benign Het
Lypd8 A C 11: 58,386,730 T113P possibly damaging Het
Lyst A T 13: 13,743,433 Q3359H probably benign Het
Lyzl1 A C 18: 4,181,156 K114T probably damaging Het
Magel2 G T 7: 62,378,977 R543L possibly damaging Het
Mak16 A G 8: 31,166,095 L120P probably damaging Het
Man2b2 C T 5: 36,815,356 D605N possibly damaging Het
Map10 CGGG CGG 8: 125,671,931 probably null Het
Map1b T G 13: 99,508,115 E93D probably benign Het
Map1s T G 8: 70,916,449 F881V possibly damaging Het
Map3k3 G A 11: 106,150,353 D383N possibly damaging Het
Map3k6 C G 4: 133,245,066 H318D probably damaging Het
Mapk13 A G 17: 28,777,533 E245G possibly damaging Het
Mapkapk5 C T 5: 121,531,591 E115K probably benign Het
March10 C A 11: 105,390,359 G367W probably damaging Het
Marveld3 G A 8: 109,948,063 R374C possibly damaging Het
Mast4 T G 13: 102,738,519 K1255T probably damaging Het
Maz GGCCCTG GG 7: 127,024,474 probably null Het
Mcf2 T C X: 60,178,713 H65R probably benign Het
Mcm6 T G 1: 128,344,298 N454T probably damaging Het
Mcpt4 T A 14: 56,060,510 R195* probably null Het
Mdm1 A C 10: 118,158,362 K380N possibly damaging Het
Mdm4 A G 1: 132,994,547 S286P probably benign Het
Med13l C A 5: 118,749,641 T1660K probably damaging Het
Med14 A C X: 12,677,606 L1451R probably damaging Het
Megf11 A T 9: 64,660,476 S416C probably damaging Het
Megf8 G A 7: 25,339,669 E902K possibly damaging Het
Mep1a C G 17: 43,491,596 W192C probably damaging Het
Mfap3 T A 11: 57,528,142 F43I possibly damaging Het
Mfhas1 C G 8: 35,590,236 P622A probably benign Het
Mgam G C 6: 40,643,060 V28L probably benign Het
Mgp T G 6: 136,874,263 probably null Het
Micall2 T A 5: 139,706,894 K908M probably damaging Het
Micall2 A C 5: 139,716,295 L398V probably benign Het
Mill2 G A 7: 18,856,399 probably null Het
Mir1966 C T 8: 105,615,571 R130* probably null Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mkx C T 18: 6,936,975 A319T probably damaging Het
Mn1 T A 5: 111,418,280 F39I possibly damaging Het
Morc2b A T 17: 33,136,086 I904N possibly damaging Het
Mpo T G 11: 87,795,245 F74V probably benign Het
Mpv17l2 T G 8: 70,759,410 K139T probably damaging Het
Mrgprb4 A G 7: 48,198,682 L166P possibly damaging Het
Mrgprg C G 7: 143,764,656 A240P probably damaging Het
Mrgprx1 T G 7: 48,021,129 K290T probably damaging Het
Mroh5 G A 15: 73,788,031 A320V possibly damaging Het
Mrpl1 T G 5: 96,262,069 M267R probably damaging Het
Mrpl2 A G 17: 46,647,478 K62R probably null Het
Mrps36 T G 13: 100,739,133 S58R possibly damaging Het
Msantd3 A C 4: 48,552,525 D38A probably damaging Het
Mta1 C T 12: 113,133,200 P547L probably benign Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Mtcl1 C T 17: 66,343,728 A1132T probably benign Het
Mtf2 A G 5: 108,087,329 D139G probably damaging Het
Mthfd1l T G 10: 4,007,844 F294V probably benign Het
Mtus2 G A 5: 148,303,263 probably benign Het
Muc4 A T 16: 32,756,076 probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Muc5ac A C 7: 141,811,692 T1984P possibly damaging Het
Muc5b A G 7: 141,862,214 S2966G probably benign Het
Mup3 G C 4: 62,087,189 L15V unknown Het
Mvd G C 8: 122,439,730 A56G probably benign Het
Mvk G T 5: 114,458,934 G321W probably damaging Het
Mxra7 G T 11: 116,804,606 N157K probably benign Het
Mybpc2 T C 7: 44,516,503 K256R possibly damaging Het
Mybpc3 A G 2: 91,135,359 E1172G probably benign Het
Myh11 AGG AG 16: 14,269,262 probably null Het
Myh2 GTATTTATTTA GTATTTA 11: 67,180,763 probably benign Het
Myh2 C T 11: 67,191,449 L1326F probably damaging Het
Myh6 C T 14: 54,956,997 R725H probably damaging Het
Myh8 A C 11: 67,298,592 K1198T probably damaging Het
Myh9 A G 15: 77,775,258 L96P probably damaging Het
Myo18b G A 5: 112,692,943 S2328L possibly damaging Het
Myo18b C T 5: 112,757,484 E2083K probably benign Het
Myo1d T G 11: 80,674,898 N367T probably benign Het
Myo5b G C 18: 74,744,749 E1606D probably benign Het
Myo5c C G 9: 75,245,059 S76R probably damaging Het
Myrf C A 19: 10,221,298 Q195H probably damaging Het
Nacc1 G C 8: 84,673,286 A434G probably damaging Het
Naip2 A T 13: 100,161,909 Y540N probably benign Het
Nap1l2 T G X: 103,185,196 N372T probably damaging Het
Nat8 G T 6: 85,831,193 probably benign Het
Nav1 T C 1: 135,470,724 T707A probably benign Het
Nbea G A 3: 55,723,163 T2251I probably benign Het
Nbeal2 G C 9: 110,632,372 A1536G possibly damaging Het
Ncapg T G 5: 45,679,880 L431R probably damaging Het
Nck2 A C 1: 43,554,383 N250T possibly damaging Het
Nckap5 G A 1: 126,024,832 R1264C possibly damaging Het
Nckipsd G C 9: 108,814,677 K492N probably benign Het
Ncor2 T A 5: 125,067,788 S597C unknown Het
Ncor2 C T 5: 125,086,840 probably null Het
Ndn T G 7: 62,349,134 F243V probably damaging Het
Ndufs6 A G 13: 73,328,436 V4A probably benign Het
Neb C T 2: 52,169,872 V2321I possibly damaging Het
Neb G C 2: 52,223,152 P7A probably benign Het
Neb T A 2: 52,308,567 K423M probably damaging Het
Nedd4 G A 9: 72,670,078 V62M probably benign Het
Nek7 C A 1: 138,515,625 V197L probably null Het
Nelfcd GTT GT 2: 174,426,494 probably null Het
Nell2 A T 15: 95,435,097 L194M probably damaging Het
Neurod6 G A 6: 55,679,362 Q97* probably null Het
Nfkbiz G C 16: 55,816,438 A500G probably damaging Het
Nfkbiz T C 16: 55,818,236 Y287C probably damaging Het
Nfrkb A C 9: 31,411,333 S900R possibly damaging Het
Nipbl T A 15: 8,307,882 E2065D probably damaging Het
Nkapl C G 13: 21,468,303 G47R unknown Het
Nlrc5 A G 8: 94,504,464 D1275G possibly damaging Het
Nlrp12 T C 7: 3,222,537 K1034R probably benign Het
Nlrp14 T G 7: 107,186,622 L635R probably damaging Het
Nlrp3 G C 11: 59,551,860 S746T possibly damaging Het
Nlrp4a T C 7: 26,454,163 V713A probably benign Het
Nlrp4c A C 7: 6,066,636 K512T probably damaging Het
Nlrp4f C T 13: 65,194,302 E510K probably benign Het
Nlrp4g T G 9: 124,349,201 noncoding transcript Het
Nlrp5 G A 7: 23,404,167 E20K possibly damaging Het
Nlrp5 T C 7: 23,417,586 L245P probably damaging Het
Nlrp9b T G 7: 20,023,743 F302V probably benign Het
Nme8 T A 13: 19,688,957 E172D possibly damaging Het
Nnt G A 13: 119,338,446 S649L probably damaging Het
Nod2 G C 8: 88,664,146 Q345H probably damaging Het
Nol4 C T 18: 22,921,902 S157N probably damaging Het
Nolc1 G T 19: 46,083,098 probably benign Het
Notch1 T G 2: 26,477,115 D680A probably damaging Het
Notch3 C G 17: 32,158,652 G150A possibly damaging Het
Notch4 C T 17: 34,587,915 P1942L probably damaging Het
Nr3c2 C A 8: 76,908,632 Q121K possibly damaging Het
Nr4a2 C T 2: 57,111,614 G213S probably damaging Het
Nrg1 G C 8: 31,918,005 L67V possibly damaging Het
Nrxn1 T A 17: 90,059,505 D31V probably damaging Het
Nsd1 A C 13: 55,213,848 S210R possibly damaging Het
Nsd2 T C 5: 33,855,738 probably null Het
Nsd3 CCTTCT CCT 8: 25,641,002 probably benign Het
Nsun2 A T 13: 69,615,465 K103M probably damaging Het
Ntn5 G C 7: 45,694,203 G322A probably damaging Het
Nudt4 C T 10: 95,552,515 G60S probably benign Het
Numa1 T G 7: 101,998,331 L423R probably damaging Het
Numa1 C A 7: 101,998,402 Q447K probably benign Het
Nup214 T C 2: 32,011,223 F940L probably benign Het
Nxpe5 G A 5: 138,240,914 probably null Het
Nxph2 G T 2: 23,400,217 A194S probably benign Het
Oaz1 C G 10: 80,826,829 R24G possibly damaging Het
Obox2 A G 7: 15,397,338 K123R possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Oca2 G T 7: 56,330,375 K609N probably null Het
Ocln G A 13: 100,535,052 R266* probably null Het
Ocstamp C A 2: 165,395,918 Q475H possibly damaging Het
Odf1 A G 15: 38,219,674 Y82C probably benign Het
Ogdh A C 11: 6,355,427 D978A probably benign Het
Olfm3 G T 3: 114,904,668 probably benign Het
Olfm5 T G 7: 104,154,150 S294R probably damaging Het
Olfr1014 T G 2: 85,777,122 D179E probably damaging Het
Olfr1026 T G 2: 85,923,798 F177V probably damaging Het
Olfr103 A C 17: 37,336,705 F176V probably damaging Het
Olfr1033 T C 2: 86,041,719 S135P probably damaging Het
Olfr1036 G T 2: 86,075,323 E194D possibly damaging Het
Olfr1037 C T 2: 86,084,982 S265N probably benign Het
Olfr1047 C A 2: 86,228,222 V250F probably damaging Het
Olfr1056 A T 2: 86,355,893 I163N probably benign Het
Olfr1058 T C 2: 86,385,756 I221V probably benign Het
Olfr1058 T G 2: 86,386,179 K80Q probably damaging Het
Olfr1080 C T 2: 86,553,966 A53T probably benign Het
Olfr1093 A G 2: 86,786,473 K248E probably damaging Het
Olfr1099 T G 2: 86,958,666 K264T probably benign Het
Olfr1106 A C 2: 87,048,433 L268V probably benign Het
Olfr1113 T G 2: 87,213,778 I295M possibly damaging Het
Olfr1116 G T 2: 87,269,575 G265* probably null Het
Olfr1124 A G 2: 87,435,159 Y224C probably damaging Het
Olfr1129 T C 2: 87,575,680 S199P possibly damaging Het
Olfr1140 G T 2: 87,746,489 A98S probably damaging Het
Olfr1145 C A 2: 87,810,746 L309I probably damaging Het
Olfr1153 G A 2: 87,896,633 A145T probably benign Het
Olfr1154 A C 2: 87,903,584 F31V possibly damaging Het
Olfr1155 G A 2: 87,943,448 P60L probably damaging Het
Olfr116 G T 17: 37,624,429 L69M probably damaging Het
Olfr1193 T G 2: 88,678,664 F263V probably damaging Het
Olfr1198 A C 2: 88,746,578 F103L probably damaging Het
Olfr120 T A 17: 37,726,092 F23I probably damaging Het
Olfr1215 C A 2: 89,001,838 G150V possibly damaging Het
Olfr1259 A G 2: 89,943,770 V115A probably benign Het
Olfr1276 T G 2: 111,257,859 V248G possibly damaging Het
Olfr1287 T C 2: 111,449,457 F106L probably benign Het
Olfr1294 A C 2: 111,537,814 I158M possibly damaging Het
Olfr1329 A C 4: 118,916,588 L293R probably damaging Het
Olfr1341 A G 4: 118,710,226 K273R probably benign Het
Olfr1387 T G 11: 49,460,456 L259R probably damaging Het
Olfr1412 T A 1: 92,588,551 S74T probably damaging Het
Olfr1424 T C 19: 12,059,129 T208A probably benign Het
Olfr1431 A C 19: 12,210,490 K308T possibly damaging Het
Olfr1432 C A 19: 12,229,224 W107C probably damaging Het
Olfr1440 A C 19: 12,394,299 K12T probably benign Het
Olfr1444 T C 19: 12,862,284 C170R probably damaging Het
Olfr1453 A C 19: 13,028,027 F101V probably benign Het
Olfr146 A C 9: 39,018,789 F251V probably damaging Het
Olfr1471 T C 19: 13,445,849 V279A possibly damaging Het
Olfr1480 T G 19: 13,529,852 F104V possibly damaging Het
Olfr1489 C A 19: 13,633,453 A114E probably damaging Het
Olfr1495 C A 19: 13,768,416 P25T probably benign Het
Olfr1499 A C 19: 13,815,548 L14R probably damaging Het
Olfr1509 C A 14: 52,451,209 F265L probably benign Het
Olfr152 G T 2: 87,782,628 L29F probably damaging Het
Olfr154 C T 2: 85,663,616 V273I probably benign Het
Olfr16 T A 1: 172,957,324 F176L probably damaging Het
Olfr166 T C 16: 19,487,048 L70P possibly damaging Het
Olfr23 G A 11: 73,941,138 M297I probably benign Het
Olfr231 C T 1: 174,117,315 A234T probably benign Het
Olfr299 T A 7: 86,465,746 F112I possibly damaging Het
Olfr340 T G 2: 36,452,906 F107C possibly damaging Het
Olfr357 A C 2: 36,997,705 K298N possibly damaging Het
Olfr364-ps1 T G 2: 37,146,385 F58V probably benign Het
Olfr373 T G 8: 72,100,517 F252L probably benign Het
Olfr378 T C 11: 73,425,105 S293G probably benign Het
Olfr410 A T 11: 74,334,692 F180I probably damaging Het
Olfr417 G A 1: 174,369,744 V276I probably benign Het
Olfr430 C T 1: 174,069,949 S217F probably damaging Het
Olfr477 G A 7: 107,990,731 R122H probably benign Het
Olfr480 C A 7: 108,066,327 C127F probably damaging Het
Olfr498 T A 7: 108,465,371 F16I probably benign Het
Olfr502 A C 7: 108,523,398 F184C probably damaging Het
Olfr512 T G 7: 108,713,538 F50V probably benign Het
Olfr513 T G 7: 108,755,104 L83V probably benign Het
Olfr514 A C 7: 108,825,896 Y34* probably null Het
Olfr519 G T 7: 108,893,773 F211L probably damaging Het
Olfr536 A C 7: 140,503,805 V218G probably benign Het
Olfr59 T C 11: 74,288,835 L63P probably damaging Het
Olfr591 A G 7: 103,172,806 L277P possibly damaging Het
Olfr60 A G 7: 140,345,804 F62L probably benign Het
Olfr61 A G 7: 140,638,220 K173R probably benign Het
Olfr615 A G 7: 103,561,059 K194R probably benign Het
Olfr615 G C 7: 103,561,390 L304F probably damaging Het
Olfr625-ps1 T G 7: 103,683,186 I156S probably benign Het
Olfr643 A C 7: 104,059,316 S95R possibly damaging Het
Olfr663 T C 7: 104,704,493 Y309H probably benign Het
Olfr667 G T 7: 104,916,666 A210E probably benign Het
Olfr67 T G 7: 103,787,365 K304T probably damaging Het
Olfr672 C A 7: 104,996,454 G150V probably benign Het
Olfr693 T G 7: 106,678,457 S10R probably benign Het
Olfr697 A T 7: 106,741,143 S264T probably benign Het
Olfr706 T A 7: 106,886,296 I174F probably damaging Het
Olfr714 C A 7: 107,074,405 D192E possibly damaging Het
Olfr716 A C 7: 107,148,212 S299R probably benign Het
Olfr742 T C 14: 50,515,527 F108L possibly damaging Het
Olfr77 T A 9: 19,920,712 F168I probably damaging Het
Olfr770 T G 10: 129,133,075 K231T probably benign Het
Olfr807 A C 10: 129,755,339 I37S possibly damaging Het
Olfr815 T C 10: 129,902,683 E9G possibly damaging Het
Olfr821 A C 10: 130,033,788 K54T probably damaging Het
Olfr832 G A 9: 18,945,421 V258I possibly damaging Het
Olfr847 G A 9: 19,375,684 L66F probably damaging Het
Olfr866 A G 9: 20,027,279 S220P probably damaging Het
Olfr877 A C 9: 37,855,318 S167R probably benign Het
Olfr888 T C 9: 38,109,586 V295A probably damaging Het
Olfr895 T C 9: 38,268,612 L33S probably damaging Het
Olfr910 T C 9: 38,539,149 F85L probably damaging Het
Olfr911-ps1 T G 9: 38,523,859 N42K probably damaging Het
Olfr945 G A 9: 39,257,871 S270L probably benign Het
Olfr980 A G 9: 40,006,596 S118P probably damaging Het
Omg G C 11: 79,502,320 N237K possibly damaging Het
Orc2 A C 1: 58,476,516 F230V probably benign Het
Osbpl3 A G 6: 50,297,097 F846L probably damaging Het
Pabpc1l G C 2: 164,032,324 probably null Het
Pah C T 10: 87,571,291 S303F probably damaging Het
Paip2b T G 6: 83,808,882 N122T probably benign Het
Pak4 G T 7: 28,565,228 T83N probably damaging Het
Pamr1 C A 2: 102,634,446 F313L possibly damaging Het
Papln C G 12: 83,776,376 P396A probably benign Het
Papss1 C G 3: 131,642,967 H559Q possibly damaging Het
Parp14 C G 16: 35,841,586 D1360H probably damaging Het
Pask C T 1: 93,316,801 S1166N probably damaging Het
Pbk T A 14: 65,813,948 V145D probably damaging Het
Pbrm1 G A 14: 31,110,454 R1443Q possibly damaging Het
Pcbp3 C A 10: 76,763,323 Q326H probably benign Het
Pcdh1 G C 18: 38,198,067 R767G probably damaging Het
Pcdh17 A G 14: 84,448,274 K727R possibly damaging Het
Pcdha2 G T 18: 36,941,121 G602C probably damaging Het
Pcdha6 G A 18: 36,969,217 A488T probably damaging Het
Pcdhac1 G T 18: 37,092,190 L685F probably damaging Het
Pcdhac1 G T 18: 37,092,566 A811S probably damaging Het
Pcdhb21 A G 18: 37,514,541 E241G probably benign Het
Pcdhb22 A C 18: 37,519,345 T289P probably benign Het
Pcdhb6 T A 18: 37,335,146 D373E probably damaging Het
Pcdhga11 G C 18: 37,756,184 G82R probably damaging Het
Pcmtd1 C T 1: 7,163,330 P222L possibly damaging Het
Pcnx2 C T 8: 125,826,928 E1151K probably damaging Het
Pcnx2 T G 8: 125,866,018 S736R probably damaging Het
Pcsk5 A G 19: 17,463,374 L1284P probably damaging Het
Pdgfra C T 5: 75,166,577 S145F probably benign Het
Pdrg1 C T 2: 153,014,037 A46T probably damaging Het
Pds5a A C 5: 65,618,986 I88M probably damaging Het
Pdzk1 A G 3: 96,854,557 N162D probably benign Het
Pelp1 A G 11: 70,396,890 L402P probably damaging Het
Pet2 A G X: 89,406,337 V62A probably benign Het
Pex1 G A 5: 3,606,075 A301T probably benign Het
Pex6 A T 17: 46,712,222 Q241H possibly damaging Het
Pgm3 A G 9: 86,564,707 F253L probably damaging Het
Pi4k2b G A 5: 52,760,931 R367Q possibly damaging Het
Pi4kb T G 3: 94,984,509 F179V probably damaging Het
Pid1 T G 1: 84,116,014 N51T probably benign Het
Piezo2 C T 18: 63,069,994 G1525D probably damaging Het
Piga A C X: 164,422,909 K88N probably damaging Het
Pigo G C 4: 43,019,409 P970A probably damaging Het
Pik3r6 G A 11: 68,525,602 V6M probably damaging Het
Piwil4 G A 9: 14,734,517 H142Y probably damaging Het
Pkd1 T G 17: 24,565,605 L375R probably benign Het
Pkd2 T G 5: 104,498,861 L780V probably damaging Het
Pkdcc A G 17: 83,222,150 E380G probably damaging Het
Pla2g12a C T 3: 129,890,380 S136F probably benign Het
Pla2g2c T C 4: 138,734,286 F22S probably damaging Het
Pla2g4c A T 7: 13,329,753 Q48H probably benign Het
Plb1 T G 5: 32,310,847 F503V probably damaging Het
Plb1 C T 5: 32,310,917 S526L probably benign Het
Plcb1 A C 2: 135,220,846 E27D probably benign Het
Plcl2 C A 17: 50,606,992 P343H probably damaging Het
Pld1 A C 3: 28,029,243 I171L probably benign Het
Plod2 T G 9: 92,603,035 F551V probably benign Het
Plxna2 A C 1: 194,644,441 I228L possibly damaging Het
Plxna2 A G 1: 194,764,539 N786D probably benign Het
Plxnd1 C A 6: 115,967,510 S1033I probably benign Het
Pmfbp1 A C 8: 109,513,944 E219D probably damaging Het
Pml G T 9: 58,234,590 L320M probably damaging Het
Pnisr C G 4: 21,873,684 R476G probably benign Het
Pnliprp2 G A 19: 58,762,325 A149T probably damaging Het
Pnp T G 14: 50,951,495 D248E probably benign Het
Pnpla5 A G 15: 84,123,071 S15P probably damaging Het
Pogz T A 3: 94,879,076 F992I probably damaging Het
Pole C T 5: 110,327,865 L1847F possibly damaging Het
Polr2b T G 5: 77,342,722 I903S possibly damaging Het
Polr2b G A 5: 77,345,401 G1077S probably damaging Het
Polr3a A C 14: 24,479,724 V266G probably damaging Het
Pop1 C G 15: 34,499,319 A10G probably damaging Het
Pop7 T C 5: 137,502,011 Y20C probably damaging Het
Postn A T 3: 54,375,127 D503V probably benign Het
Pou4f2 C G 8: 78,435,601 Q124H probably benign Het
Ppl G A 16: 5,089,507 R975W probably damaging Het
Ppp1cc C T 5: 122,172,753 S182F possibly damaging Het
Ppp1r10 ACATGATGTCCCTAGCCAT ACAT 17: 35,930,767 probably benign Het
Ppp1r7 T C 1: 93,352,588 L126P probably damaging Het
Ppp2r1b A C 9: 50,866,911 E309D probably damaging Het
Prdm1 G A 10: 44,441,925 R301W probably damaging Het
Prg2 G T 2: 84,982,265 K106N possibly damaging Het
Prkg2 A T 5: 99,024,804 H17Q probably benign Het
Prob1 G C 18: 35,652,769 P811A possibly damaging Het
Prox1 G C 1: 190,161,999 A83G probably damaging Het
Prr23a1 G A 9: 98,843,347 R254Q possibly damaging Het
Prr27 G A 5: 87,842,646 R31H probably damaging Het
Prr30 G C 14: 101,198,140 Q329E probably benign Het
Prrc2b C A 2: 32,214,429 N1306K probably benign Het
Prrc2b G A 2: 32,216,732 R1582K probably damaging Het
Prrx1 A C 1: 163,261,877 L127R probably damaging Het
Prss36 G A 7: 127,934,537 R32* probably null Het
Prss53 C T 7: 127,887,398 W352* probably null Het
Psd3 T C 8: 67,906,260 silent Het
Psg17 G A 7: 18,816,910 T340I probably benign Het
Psg25 T A 7: 18,529,591 R102S probably benign Het
Psmd11 A ATC 11: 80,471,550 probably null Het
Ptcra G C 17: 46,763,595 A7G probably damaging Het
Pten C T 19: 32,776,051 A39V probably damaging Het
Pten A C 19: 32,799,998 T131P probably damaging Het
Ptgfrn T G 3: 101,056,437 T620P probably damaging Het
Ptprn T A 1: 75,260,620 M20L possibly damaging Het
Ptprq C T 10: 107,699,672 A411T possibly damaging Het
Ptprt A G 2: 162,238,121 S253P possibly damaging Het
Rab3gap2 A T 1: 185,281,677 L1173F probably damaging Het
Rac1 C A 5: 143,514,719 A59S probably damaging Het
Rad21 T G 15: 51,982,626 K16T probably damaging Het
Rad21l C T 2: 151,668,019 R54Q probably damaging Het
Rad9b A G 5: 122,333,372 F210L possibly damaging Het
Raet1e A C 10: 22,181,951 T206P possibly damaging Het
Ralgapa2 T G 2: 146,434,905 S472R probably benign Het
Ranbp2 GGT GGTTTGTGCTCCGT 10: 58,477,983 probably null Het
Ranbp2 A T 10: 58,492,893 Q2871H probably benign Het
Rapgefl1 C G 11: 98,845,895 P285R probably damaging Het
Rasgrp4 A C 7: 29,150,536 probably benign Het
Rassf7 C G 7: 141,217,145 S90R probably damaging Het
Rassf8 A G 6: 145,815,482 Q178R probably benign Het
Rassf8 A C 6: 145,816,616 E371A probably benign Het
Rb1cc1 AT ATT 1: 6,249,018 probably null Het
Rbm12b1 G T 4: 12,146,079 V684L probably benign Het
Rdh16f1 A C 10: 127,788,833 K180T probably damaging Het
Rec8 A T 14: 55,625,147 K553M probably damaging Het
Reg1 G T 6: 78,426,918 E23* probably null Het
Rergl C A 6: 139,493,426 E135* probably null Het
Resp18 T C 1: 75,278,291 K6R possibly damaging Het
Rev3l C A 10: 39,824,318 Q1604K probably benign Het
Rfc3 C T 5: 151,644,862 R213H probably benign Het
Rfwd3 C A 8: 111,297,606 G28V probably benign Het
Rfx3 G A 19: 27,837,450 S169F probably damaging Het
Rfx8 T G 1: 39,682,966 E286D possibly damaging Het
Rgl1 G A 1: 152,675,020 probably benign Het
Rgs11 G C 17: 26,205,772 Q218H probably benign Het
Rgs7 T C 1: 175,084,020 E345G possibly damaging Het
Rims1 C G 1: 22,288,586 A1258P probably damaging Het
Rint1 A G 5: 23,805,314 N174D probably benign Het
Ripk3 T G 14: 55,787,926 E60D probably damaging Het
Rnf146 G A 10: 29,347,572 A106V probably damaging Het
Rnf213 A G 11: 119,477,254 K4705R possibly damaging Het
Rnmt C T 18: 68,307,674 S136L probably benign Het
Rp1l1 C T 14: 64,028,758 H598Y possibly damaging Het
Rp1l1 T G 14: 64,030,378 F1138V probably benign Het
Rpgrip1l A T 8: 91,220,179 *1265R probably null Het
Rpgrip1l T G 8: 91,260,975 K818T possibly damaging Het
Rpgrip1l A T 8: 91,270,120 F109I possibly damaging Het
Rpl12 T A 2: 32,963,019 I82N possibly damaging Het
Rpl13a G C 7: 45,127,513 A24G probably damaging Het
Rpp14 A C 14: 8,090,539 E154D probably benign Het
Rps19 G C 7: 24,886,107 probably benign Het
Rptn C A 3: 93,397,427 P689H probably benign Het
Rrbp1 C A 2: 143,974,486 G741V probably damaging Het
Rreb1 G A 13: 37,948,937 R1696K probably benign Het
Rsl1d1 C T 16: 11,202,385 G59R possibly damaging Het
Rtl1 T A 12: 109,592,319 T1029S probably benign Het
Runx1 C T 16: 92,605,792 A421T probably damaging Het
Runx1t1 G A 4: 13,865,892 R380Q possibly damaging Het
Rxfp1 C T 3: 79,705,704 G20R probably damaging Het
Ryr3 C A 2: 112,900,916 G683V probably damaging Het
S100a13 C G 3: 90,515,942 S80C probably damaging Het
Satb1 C G 17: 51,782,939 Q293H probably damaging Het
Satb1 G A 17: 51,782,952 S289F probably damaging Het
Sbno1 T G 5: 124,393,958 K719N possibly damaging Het
Sbno1 G T 5: 124,404,304 P308T probably damaging Het
Sbpl A C 17: 23,953,544 F134V probably damaging Het
Sbsn G T 7: 30,751,751 E64* probably null Het
Scaf8 T G 17: 3,162,983 probably benign Het
Scap A G 9: 110,372,336 N131S probably damaging Het
Scarf1 C T 11: 75,525,490 A586V probably damaging Het
Scd1 C A 19: 44,397,923 S355I probably benign Het
Scgb2b26 A C 7: 33,944,367 F49L probably benign Het
Scn11a A G 9: 119,755,242 F1436L probably damaging Het
Scn7a C T 2: 66,713,951 E399K probably damaging Het
Scrib G A 15: 76,048,231 P1560S probably damaging Het
Sctr GT G 1: 120,036,406 probably null Het
Sec16a G A 2: 26,439,093 S970F probably damaging Het
Sec16b A G 1: 157,558,024 probably null Het
Sec23a A G 12: 59,004,576 F94L probably benign Het
Sel1l3 C A 5: 53,116,196 A1081S probably damaging Het
Selenok G A 14: 29,973,444 G93E probably damaging Het
Selenov G A 7: 28,290,668 T137I possibly damaging Het
Sema3b A C 9: 107,599,034 probably null Het
Sema3e G A 5: 14,226,456 S285N probably damaging Het
Sema5b T G 16: 35,660,590 F815V probably damaging Het
Serac1 G A 17: 6,048,918 P533S probably damaging Het
Serpina1a C A 12: 103,854,667 probably null Het
Serpinb3b T G 1: 107,157,751 T87P probably damaging Het
Serpinb6c A G 13: 33,893,872 F172L probably damaging Het
Serpinb6c G A 13: 33,893,923 P155S probably benign Het
Serpinb6d T C 13: 33,671,254 F304L possibly damaging Het
Sertad4 G T 1: 192,847,031 T159N probably damaging Het
Setbp1 G C 18: 78,859,594 P286R probably damaging Het
Sez6 T G 11: 77,973,197 F502V possibly damaging Het
Sez6l T G 5: 112,440,915 Q644P probably damaging Het
Sfmbt2 A C 2: 10,579,183 T784P probably damaging Het
Sgo2b C A 8: 63,927,005 G931V probably damaging Het
Sgo2b T G 8: 63,928,422 T459P possibly damaging Het
Sgtb T C 13: 104,131,939 L118P probably damaging Het
Shank1 C T 7: 44,352,166 A1103V unknown Het
Siglech A G 7: 55,768,994 I182V possibly damaging Het
Sirpa C A 2: 129,618,535 A54D probably damaging Het
Slamf1 T G 1: 171,799,592 V334G probably damaging Het
Slc14a2 T G 18: 78,195,780 K208T probably damaging Het
Slc15a1 C T 14: 121,480,054 R272Q probably benign Het
Slc15a1 A G 14: 121,491,044 L65P probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc1a5 C T 7: 16,797,669 P533L probably damaging Het
Slc22a12 G A 19: 6,538,463 H342Y possibly damaging Het
Slc22a2 G A 17: 12,614,776 E448K probably benign Het
Slc22a28 A C 19: 8,062,398 S537A probably damaging Het
Slc22a3 A T 17: 12,425,681 C472* probably null Het
Slc22a30 C A 19: 8,335,775 V549F probably damaging Het
Slc22a6 A G 19: 8,621,833 D276G probably benign Het
Slc23a1 T C 18: 35,624,508 N237D probably benign Het
Slc25a1 C G 16: 17,927,206 G130A probably benign Het
Slc28a1 C G 7: 81,138,168 P268A probably damaging Het
Slc2a6 G A 2: 27,021,987 P420L probably damaging Het
Slc35a4 A C 18: 36,683,093 *325Y probably null Het
Slc48a1 C A 15: 97,790,681 Y74* probably null Het
Slc4a10 T G 2: 62,228,571 L141V probably damaging Het
Slc4a8 C G 15: 100,761,951 P8A probably benign Het
Slc6a19 C T 13: 73,689,730 E217K possibly damaging Het
Slc6a5 C G 7: 49,911,857 P46A probably benign Het
Slc7a14 G C 3: 31,223,999 L486V probably benign Het
Slco2a1 C A 9: 103,079,527 L513M probably benign Het
Slit2 A G 5: 48,302,353 Y1308C probably damaging Het
Slurp2 C A 15: 74,743,101 V64L probably damaging Het
Smad5 A T 13: 56,728,628 R258S probably benign Het
Smarcc2 G C 10: 128,461,434 G65A probably damaging Het
Smco1 A T 16: 32,273,215 D37V probably damaging Het
Smg1 A C 7: 118,154,635 probably benign Het
Smg1 C A 7: 118,168,661 E1665* probably null Het
Smg1 A G 7: 118,178,399 L1358P possibly damaging Het
Snx15 T C 19: 6,121,411 E211G probably damaging Het
Snx5 C T 2: 144,252,491 R373Q probably benign Het
Sod2 T A 17: 13,013,538 L150H probably damaging Het
Sorcs1 C G 19: 50,222,143 Q761H probably benign Het
Sox12 C G 2: 152,397,465 W78C probably damaging Het
Sox17 G T 1: 4,492,302 S160Y probably damaging Het
Sp9 G C 2: 73,273,230 A43P possibly damaging Het
Spag17 A G 3: 100,095,630 K1890R probably benign Het
Speer4b C G 5: 27,497,941 E188D probably benign Het
Speer4f1 A C 5: 17,479,479 E168D probably damaging Het
Spen C A 4: 141,477,976 E1113D unknown Het
Spen T C 4: 141,477,977 E1113G unknown Het
Sphkap T A 1: 83,276,608 N1140I probably damaging Het
Sphkap T G 1: 83,278,604 T475P probably damaging Het
Spinkl G C 18: 44,174,559 L12V probably damaging Het
Spire1 C A 18: 67,495,152 R509L possibly damaging Het
Spon1 G A 7: 113,766,386 A20T possibly damaging Het
Srd5a3 T C 5: 76,149,821 F33L possibly damaging Het
Srebf2 T G 15: 82,194,921 F783L probably benign Het
Ssbp4 A C 8: 70,599,835 probably benign Het
Ssc5d A C 7: 4,928,434 E213D probably damaging Het
Ssh2 C A 11: 77,449,495 T491N probably damaging Het
Ssrp1 G A 2: 85,040,653 R211H probably damaging Het
Ssxb3 T G X: 8,589,188 S5R probably benign Het
Stam C A 2: 14,139,090 S397* probably null Het
Stambpl1 A T 19: 34,226,627 N39I probably damaging Het
Stap2 G C 17: 55,999,748 A275G probably benign Het
Stard4 G T 18: 33,203,717 Q182K probably benign Het
Stard4 T C 18: 33,203,720 S181G probably benign Het
Stil T G 4: 115,006,693 L44R probably damaging Het
Stk31 G T 6: 49,417,188 probably null Het
Ston2 T G 12: 91,649,067 N189T possibly damaging Het
Stxbp5l T G 16: 37,204,489 Q582H probably benign Het
Sult2a1 T C 7: 13,801,414 Q238R probably benign Het
Sult2a1 A T 7: 13,801,435 F231Y probably benign Het
Sult2a1 T C 7: 13,804,036 I187M probably benign Het
Sult2a6 T C 7: 14,225,894 Q238R probably benign Het
Sycp2 T G 2: 178,374,367 E767D probably benign Het
Sycp2 C T 2: 178,381,934 V430I probably benign Het
Syna C T 5: 134,558,529 R522Q probably benign Het
Syne4 C G 7: 30,316,336 S125C probably damaging Het
Syngap1 A C 17: 26,961,576 D653A probably damaging Het
Synm A C 7: 67,751,886 L285V probably damaging Het
Synpo2l T G 14: 20,665,967 E183D probably damaging Het
Syt10 C T 15: 89,841,639 G44D probably benign Het
Szrd1 C A 4: 141,118,587 R99L probably damaging Het
Taar9 G C 10: 24,108,965 C190W probably damaging Het
Tab2 A T 10: 7,920,266 S77T possibly damaging Het
Taf1a G T 1: 183,404,460 R291M possibly damaging Het
Taf5l C A 8: 123,997,338 G581* probably null Het
Tars G T 15: 11,391,884 P255H probably benign Het
Tas1r2 C T 4: 139,660,424 A398V possibly damaging Het
Tas2r109 T C 6: 132,980,301 Q222R probably benign Het
Tas2r115 G T 6: 132,737,081 C302* probably null Het
Tas2r116 A G 6: 132,855,948 N171D probably benign Het
Tbc1d1 A G 5: 64,275,393 probably null Het
Tbc1d13 T C 2: 30,134,872 probably null Het
Tbc1d4 A C 14: 101,452,423 V1049G probably damaging Het
Tbc1d5 C A 17: 50,963,696 R169I probably damaging Het
Tbxa2r G C 10: 81,333,215 G246A probably damaging Het
Tcaim A C 9: 122,833,657 K430T probably benign Het
Tchh C T 3: 93,445,682 Q810* probably null Het
Tcp10a G C 17: 7,326,449 A58P probably damaging Het
Tctn1 C G 5: 122,251,641 A273P probably damaging Het
Tctn3 A C 19: 40,607,346 F332V possibly damaging Het
Tdrd6 T G 17: 43,626,518 E1213A probably benign Het
Tead4 G C 6: 128,270,904 R57G probably damaging Het
Teddm1a G A 1: 153,892,026 G79R probably benign Het
Tekt5 G A 16: 10,358,377 R435W probably damaging Het
Tenm1 G A X: 42,899,835 P290S probably damaging Het
Tenm2 C T 11: 36,273,267 A384T probably damaging Het
Terf2 A G 8: 107,081,223 L240P probably damaging Het
Tex13c2 A T X: 42,490,562 S211C probably damaging Het
Tex15 A C 8: 33,571,315 K532Q possibly damaging Het
Tex15 A G 8: 33,571,810 I697V possibly damaging Het
Tex15 A G 8: 33,574,870 N1443D probably benign Het
Them6 G A 15: 74,721,569 R92H probably benign Het
Thsd1 G A 8: 22,252,219 R301H probably damaging Het
Thumpd3 C G 6: 113,056,030 T243S probably benign Het
Tiam2 C T 17: 3,415,019 S341F probably benign Het
Tie1 A G 4: 118,484,429 C229R probably damaging Het
Timm44 C T 8: 4,268,004 E135K probably benign Het
Tlr11 T G 14: 50,362,338 F594V possibly damaging Het
Tlr4 G A 4: 66,929,082 D149N probably benign Het
Tm9sf3 A G 19: 41,232,378 Y382H probably damaging Het
Tmc3 A C 7: 83,603,468 K359T probably damaging Het
Tmem132a G A 19: 10,858,935 R744C probably damaging Het
Tmem132c G A 5: 127,504,921 S400N probably benign Het
Tmem189 G C 2: 167,644,864 Y198* probably null Het
Tmem198 C A 1: 75,480,262 Q11K probably benign Het
Tmem219 G C 7: 126,891,674 P198A possibly damaging Het
Tmem246 A G 4: 49,587,135 L11P probably damaging Het
Tmem270 A C 5: 134,906,656 L15R probably damaging Het
Tmem39a C A 16: 38,575,778 F124L possibly damaging Het
Tmem39b C G 4: 129,692,477 A4P probably benign Het
Tmem45b A G 9: 31,428,027 F131L probably damaging Het
Tmppe G A 9: 114,405,077 R148H probably benign Het
Tmprss4 T A 9: 45,175,465 N333Y probably damaging Het
Tnni3k G C 3: 154,939,670 A526G probably damaging Het
Tnpo1 C G 13: 98,860,670 G417A probably benign Het
Tnpo3 C G 6: 29,565,843 G504A probably benign Het
Tnr T C 1: 159,895,095 F1037L probably benign Het
Tnrc6b C T 15: 80,927,690 R813* probably null Het
Togaram2 A G 17: 71,714,280 K687R possibly damaging Het
Tox C A 4: 6,688,450 R519M probably damaging Het
Tpo T C 12: 30,094,782 D656G probably damaging Het
Trank1 G A 9: 111,364,710 D601N probably damaging Het
Trav13d-4 C G 14: 53,073,170 T76S probably benign Het
Trav16n C T 14: 53,351,573 A101V possibly damaging Het
Trav5-4 A G 14: 53,704,239 E23G possibly damaging Het
Trav8d-2 T G 14: 53,042,808 L85R probably damaging Het
Tril G A 6: 53,818,920 T439M probably benign Het
Trim30a C A 7: 104,435,654 W116C probably damaging Het
Trim30b C A 7: 104,366,100 S27I probably damaging Het
Trim42 T G 9: 97,369,622 N75H probably benign Het
Trim43c A C 9: 88,842,935 probably null Het
Trim45 A C 3: 100,925,640 E396D probably benign Het
Trim5 C T 7: 104,266,225 A294T possibly damaging Het
Trim67 A G 8: 124,817,041 Q380R probably damaging Het
Triml1 T A 8: 43,130,398 I389F probably damaging Het
Trip12 A C 1: 84,766,168 N500K probably damaging Het
Trip4 G A 9: 65,864,415 R278* probably null Het
Trp53bp1 T C 2: 121,253,645 K247E probably benign Het
Trp63 G A 16: 25,763,313 R37K probably benign Het
Trpm7 G T 2: 126,797,281 A1711E probably damaging Het
Trrap A G 5: 144,834,197 K2802R probably benign Het
Tspan5 G C 3: 138,898,326 W228C possibly damaging Het
Tssk4 A G 14: 55,650,923 K83R probably damaging Het
Ttbk1 C A 17: 46,446,325 A1128S probably benign Het
Ttc16 C A 2: 32,769,333 L251F probably damaging Het
Ttc23l C A 15: 10,533,667 R263S probably damaging Het
Ttc28 G C 5: 111,286,315 G2405A probably benign Het
Ttc30b T G 2: 75,937,982 E142D probably benign Het
Ttc39c G T 18: 12,686,963 M15I possibly damaging Het
Ttll1 C T 15: 83,498,189 V201I probably damaging Het
Ttll12 T C 15: 83,582,078 Q394R probably damaging Het
Ttll2 T G 17: 7,351,526 D334A probably damaging Het
Ttn T G 2: 76,738,687 E25541D possibly damaging Het
Ttn C G 2: 76,746,951 E24533Q probably damaging Het
Ttn G T 2: 76,752,230 A14446E probably damaging Het
Ttn A G 2: 76,752,519 W20931R probably damaging Het
Ttn T G 2: 76,787,269 K14540T probably damaging Het
Ttn T G 2: 76,848,325 probably benign Het
Tubal3 A C 13: 3,933,511 E430D probably benign Het
Tubb3 G C 8: 123,421,534 G402A probably damaging Het
Tubd1 A T 11: 86,555,167 K211M probably damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Tubgcp5 G A 7: 55,815,101 G577S probably benign Het
Tulp2 A C 7: 45,521,986 K404T probably damaging Het
Tyro3 T G 2: 119,809,467 I377S probably benign Het
Ube4b A G 4: 149,335,125 I1042T possibly damaging Het
Ubl4b T G 3: 107,554,403 E180D unknown Het
Ubqln5 T A 7: 104,128,971 K215N possibly damaging Het
Ubqlnl A G 7: 104,149,993 V99A probably damaging Het
Ubr3 A G 2: 69,922,367 T322A probably benign Het
Uggt1 A C 1: 36,174,191 F861C probably damaging Het
Ugt1a10 T C 1: 88,055,842 F121L probably benign Het
Umps CCTGACTGA CCTGA 16: 33,966,825 probably null Het
Unc13a C A 8: 71,654,803 probably null Het
Unc5c T G 3: 141,733,900 L111V probably damaging Het
Unc79 C A 12: 103,021,012 H187N probably damaging Het
Unc80 C G 1: 66,646,451 P2245A possibly damaging Het
Ush2a T C 1: 188,911,983 L4514P probably benign Het
Ush2a A C 1: 188,947,004 N4803T probably benign Het
Usp17lb G A 7: 104,841,129 P197L probably benign Het
Usp43 C A 11: 67,856,040 R942L probably benign Het
Usp51 C T X: 153,008,222 P271S probably benign Het
Usp51 C T X: 153,008,223 P271L probably benign Het
Vmn1r12 T G 6: 57,158,981 L21R probably damaging Het
Vmn1r176 C T 7: 23,835,173 R185H probably benign Het
Vmn1r179 A G 7: 23,928,482 I33V probably benign Het
Vmn1r188 T C 13: 22,088,280 W135R probably damaging Het
Vmn1r212 A C 13: 22,883,762 F134V probably damaging Het
Vmn1r229 C A 17: 20,815,065 L191M probably damaging Het
Vmn1r232 C A 17: 20,913,838 V167F probably benign Het
Vmn1r4 G A 6: 56,957,065 V185M possibly damaging Het
Vmn1r46 A G 6: 89,976,741 R191G probably damaging Het
Vmn1r72 T G 7: 11,670,173 N116T probably benign Het
Vmn1r78 A C 7: 12,152,714 K84T probably damaging Het
Vmn2r10 A G 5: 108,996,113 F657S probably damaging Het
Vmn2r101 C A 17: 19,588,975 A122D possibly damaging Het
Vmn2r103 C A 17: 19,795,047 S483Y probably benign Het
Vmn2r108 C T 17: 20,471,113 V383M probably benign Het
Vmn2r110 T G 17: 20,583,680 H211P probably damaging Het
Vmn2r112 C G 17: 22,605,078 S438C possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r12 G T 5: 109,092,780 H156N probably benign Het
Vmn2r16 A C 5: 109,340,515 Q418P probably benign Het
Vmn2r16 TA T 5: 109,363,913 probably null Het
Vmn2r19 T G 6: 123,308,339 L3V probably benign Het
Vmn2r23 A C 6: 123,742,108 T807P probably damaging Het
Vmn2r24 A C 6: 123,804,196 S454R probably benign Het
Vmn2r45 T A 7: 8,471,485 E848V probably benign Het
Vmn2r5 T G 3: 64,509,542 N65T probably benign Het
Vmn2r50 G C 7: 10,037,500 T758R possibly damaging Het
Vmn2r50 G T 7: 10,046,159 L432I probably benign Het
Vmn2r59 G T 7: 42,012,414 A659E possibly damaging Het
Vmn2r61 A G 7: 42,299,964 T603A possibly damaging Het
Vmn2r63 G A 7: 42,928,559 T185I probably benign Het
Vmn2r65 C A 7: 84,943,265 probably null Het
Vmn2r70 A C 7: 85,564,760 L395V possibly damaging Het
Vmn2r79 T G 7: 87,002,341 F316C probably damaging Het
Vmn2r8 A C 5: 108,801,998 F328V probably damaging Het
Vmn2r82 T G 10: 79,356,622 F11C probably damaging Het
Vmn2r87 C A 10: 130,472,314 R685M probably damaging Het
Vmn2r90 C A 17: 17,733,617 A681E probably damaging Het
Vmn2r93 A C 17: 18,326,403 K846Q probably damaging Het
Vmn2r95 C A 17: 18,440,401 F358L probably benign Het
Vmn2r96 T A 17: 18,597,366 L594I possibly damaging Het
Vmn2r99 C A 17: 19,379,301 Q416K probably benign Het
Vmo1 T A 11: 70,513,817 L119F probably damaging Het
Vps13c T C 9: 67,913,975 S1256P probably damaging Het
Vwa8 C T 14: 78,982,246 A478V probably benign Het
Washc4 C G 10: 83,576,741 A749G probably benign Het
Wbp2 T A 11: 116,086,913 K5* probably null Het
Wdcp A C 12: 4,850,825 K227T probably damaging Het
Wdr13 A C X: 8,125,622 F369V probably damaging Het
Wdr13 C A X: 8,125,624 S460I probably damaging Het
Wdr3 T G 3: 100,144,344 K663T probably benign Het
Wdr36 T G 18: 32,866,012 probably null Het
Wdr53 T A 16: 32,252,298 S154T probably damaging Het
Wdr5b G A 16: 36,042,443 A311T probably damaging Het
Wdr64 A T 1: 175,705,985 Q62H possibly damaging Het
Wdr82 A C 9: 106,184,800 I221L probably benign Het
Wnt5a C T 14: 28,522,728 R311C probably damaging Het
Wrap53 G A 11: 69,578,498 S144F probably damaging Het
Wsb2 C A 5: 117,377,506 P392Q probably damaging Het
Wwc1 T G 11: 35,883,482 N317T possibly damaging Het
Wwp2 G A 8: 107,555,087 E303K probably damaging Het
Xdh C T 17: 73,886,428 S1291N probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Xirp2 A G 2: 67,513,321 T1969A probably benign Het
Xpot A C 10: 121,601,323 I830S probably damaging Het
Xylb T A 9: 119,381,614 L388M probably benign Het
Ylpm1 G A 12: 85,030,155 R760K possibly damaging Het
Zadh2 G A 18: 84,094,927 V243I probably damaging Het
Zbtb34 C G 2: 33,411,108 E474Q probably damaging Het
Zc3h12b A C X: 95,899,442 K116T probably damaging Het
Zdhhc17 T C 10: 110,945,466 probably null Het
Zfat G A 15: 68,187,101 A195V probably benign Het
Zfhx2 T G 14: 55,074,180 Q352H possibly damaging Het
Zfhx3 A C 8: 108,951,357 K3013T possibly damaging Het
Zfp106 G T 2: 120,530,490 L1047I probably damaging Het
Zfp109 A G 7: 24,228,935 F358L probably benign Het
Zfp157 T C 5: 138,457,199 L553P probably damaging Het
Zfp273 A T 13: 67,825,394 I214F possibly damaging Het
Zfp326 T A 5: 105,888,630 Y136N probably damaging Het
Zfp386 G A 12: 116,054,773 E21K possibly damaging Het
Zfp42 C G 8: 43,295,805 V220L probably benign Het
Zfp507 C G 7: 35,794,277 S447T possibly damaging Het
Zfp518b C A 5: 38,674,293 S123I probably damaging Het
Zfp541 A C 7: 16,079,795 K791T probably benign Het
Zfp553 G T 7: 127,235,498 G75V probably damaging Het
Zfp57 T C 17: 37,010,138 F295L probably damaging Het
Zfp593 G C 4: 134,245,442 A21G probably benign Het
Zfp598 CCAT CCATCAT 17: 24,680,210 probably benign Het
Zfp638 A C 6: 83,944,811 K640T probably damaging Het
Zfp648 T C 1: 154,204,520 F142L probably benign Het
Zfp729b C T 13: 67,593,070 E359K possibly damaging Het
Zfp775 G A 6: 48,620,688 E499K probably damaging Het
Zfp868 TTAT TT 8: 69,611,910 probably null Het
Zfp959 A G 17: 55,898,135 R391G probably damaging Het
Zfp976 T G 7: 42,612,760 E551A possibly damaging Het
Zfx A C X: 94,079,443 L585V probably damaging Het
Zglp1 C T 9: 21,067,000 R27Q possibly damaging Het
Zhx3 GGAAG GG 2: 160,779,755 probably benign Het
Zic2 A T 14: 122,478,675 H403L probably damaging Het
Zim1 T G 7: 6,677,659 N335T possibly damaging Het
Zkscan3 T C 13: 21,388,565 K299R possibly damaging Het
Zkscan4 T G 13: 21,483,897 L173V probably damaging Het
Zmiz2 A T 11: 6,399,603 H421L probably damaging Het
Zmynd15 A C 11: 70,461,135 K60T possibly damaging Het
Zmynd8 A C 2: 165,828,171 L481R probably benign Het
Zpbp C A 11: 11,408,568 R233L probably damaging Het
Zscan18 G T 7: 12,775,067 Q169K probably benign Het
Zscan18 G A 7: 12,775,093 probably benign Het
Zscan26 T G 13: 21,445,463 K290T probably damaging Het
Other mutations in Oog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02413:Oog3 APN 4 144158151 missense probably benign 0.00
IGL02517:Oog3 APN 4 144159350 missense probably damaging 1.00
IGL02635:Oog3 APN 4 144158145 missense probably damaging 1.00
R0016:Oog3 UTSW 4 144158071 missense probably damaging 1.00
R0016:Oog3 UTSW 4 144158071 missense probably damaging 1.00
R0269:Oog3 UTSW 4 144160214 missense probably benign 0.10
R0617:Oog3 UTSW 4 144160214 missense probably benign 0.10
R1147:Oog3 UTSW 4 144158412 missense possibly damaging 0.81
R1147:Oog3 UTSW 4 144158412 missense possibly damaging 0.81
R1562:Oog3 UTSW 4 144162599 missense probably damaging 0.98
R1669:Oog3 UTSW 4 144158438 missense probably benign 0.06
R1766:Oog3 UTSW 4 144159122 missense possibly damaging 0.49
R2002:Oog3 UTSW 4 144158105 missense possibly damaging 0.96
R2109:Oog3 UTSW 4 144159512 missense probably damaging 1.00
R2394:Oog3 UTSW 4 144159314 missense probably benign 0.00
R4615:Oog3 UTSW 4 144158329 missense probably benign 0.00
R4632:Oog3 UTSW 4 144158128 missense probably benign 0.00
R4816:Oog3 UTSW 4 144159161 missense probably damaging 1.00
R5459:Oog3 UTSW 4 144159245 missense probably benign
R5547:Oog3 UTSW 4 144158028 missense probably benign 0.27
R6811:Oog3 UTSW 4 144159582 missense probably benign 0.00
R6931:Oog3 UTSW 4 144159353 missense probably benign 0.00
R7052:Oog3 UTSW 4 144160457 missense probably damaging 1.00
R7194:Oog3 UTSW 4 144162599 missense probably damaging 0.98
R7312:Oog3 UTSW 4 144160231 missense probably benign 0.08
R7486:Oog3 UTSW 4 144158172 missense probably benign 0.16
R7622:Oog3 UTSW 4 144158319 missense probably benign 0.00
Z1088:Oog3 UTSW 4 144158307 missense probably benign 0.00
Predicted Primers
Posted On2017-02-27