Incidental Mutation 'R0561:Calcr'
ID45867
Institutional Source Beutler Lab
Gene Symbol Calcr
Ensembl Gene ENSMUSG00000023964
Gene Namecalcitonin receptor
SynonymsClr
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location3685680-3764714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3692630 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 408 (I408T)
Ref Sequence ENSEMBL: ENSMUSP00000132124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075644] [ENSMUST00000115622] [ENSMUST00000168592] [ENSMUST00000170266] [ENSMUST00000171613]
Predicted Effect probably damaging
Transcript: ENSMUST00000075644
AA Change: I408T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075070
Gene: ENSMUSG00000023964
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 5.2e-85 PFAM
Pfam:Dicty_CAR 259 410 5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115622
AA Change: I371T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111285
Gene: ENSMUSG00000023964
AA Change: I371T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168592
AA Change: I371T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130243
Gene: ENSMUSG00000023964
AA Change: I371T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170266
AA Change: I408T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132124
Gene: ENSMUSG00000023964
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 2.2e-84 PFAM
Pfam:Dicty_CAR 257 399 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171613
AA Change: I371T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130083
Gene: ENSMUSG00000023964
AA Change: I371T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Haploinsufficiency may result in increased bone density due to increased bone formation. Homozygous inactivation may result in embryonic lethality. Mice homozygous for another disruption allele at this locus show a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Calcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Calcr APN 6 3717196 missense probably damaging 1.00
IGL01146:Calcr APN 6 3700144 missense possibly damaging 0.88
IGL02253:Calcr APN 6 3707523 missense probably benign 0.12
IGL02567:Calcr APN 6 3691564 missense probably damaging 1.00
IGL02729:Calcr APN 6 3707595 missense probably benign
IGL03062:Calcr APN 6 3693718 missense probably benign 0.08
R0111:Calcr UTSW 6 3717157 missense probably damaging 1.00
R1013:Calcr UTSW 6 3692621 missense probably damaging 1.00
R1628:Calcr UTSW 6 3700251 missense possibly damaging 0.53
R2152:Calcr UTSW 6 3687615 missense probably benign 0.03
R2206:Calcr UTSW 6 3717133 missense probably damaging 0.98
R2207:Calcr UTSW 6 3717133 missense probably damaging 0.98
R3403:Calcr UTSW 6 3687604 missense probably benign 0.04
R3781:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3782:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3851:Calcr UTSW 6 3693735 missense probably damaging 1.00
R3852:Calcr UTSW 6 3693735 missense probably damaging 1.00
R4190:Calcr UTSW 6 3717106 missense possibly damaging 0.82
R4387:Calcr UTSW 6 3707581 missense probably damaging 0.98
R4402:Calcr UTSW 6 3708484 critical splice donor site probably null
R4403:Calcr UTSW 6 3708484 critical splice donor site probably null
R4494:Calcr UTSW 6 3708484 critical splice donor site probably null
R4495:Calcr UTSW 6 3708484 critical splice donor site probably null
R4745:Calcr UTSW 6 3692576 missense probably damaging 0.99
R4857:Calcr UTSW 6 3708511 missense probably benign 0.29
R4883:Calcr UTSW 6 3714705 missense probably damaging 1.00
R5168:Calcr UTSW 6 3708610 missense probably benign 0.00
R5375:Calcr UTSW 6 3714651 missense probably benign 0.00
R5643:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5644:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5688:Calcr UTSW 6 3714730 synonymous probably null
R5799:Calcr UTSW 6 3707592 missense probably benign 0.13
R5920:Calcr UTSW 6 3722994 missense probably damaging 0.97
R6249:Calcr UTSW 6 3692711 missense possibly damaging 0.49
R6329:Calcr UTSW 6 3687621 missense probably damaging 1.00
R6357:Calcr UTSW 6 3714710 missense probably benign 0.00
R6365:Calcr UTSW 6 3711455 missense probably benign 0.00
R6393:Calcr UTSW 6 3708586 missense probably damaging 1.00
R6547:Calcr UTSW 6 3717177 missense probably damaging 1.00
R7034:Calcr UTSW 6 3692543 missense probably damaging 1.00
R7208:Calcr UTSW 6 3687612 missense probably benign 0.00
R7342:Calcr UTSW 6 3691536 missense probably benign 0.03
R7430:Calcr UTSW 6 3708586 missense probably damaging 1.00
R7601:Calcr UTSW 6 3687603 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCAGTAAAGGGGCCTGTGTATC -3'
(R):5'- AAAAGTCACTCGCTTGCTTGCTTTC -3'

Sequencing Primer
(F):5'- GAAGGCTATGCATTTTGACTCC -3'
(R):5'- AACATTGTCCGCGTGCTT -3'
Posted On2013-06-11