Incidental Mutation 'R0561:Megf8'
ID45871
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25328832 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 274 (P274S)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably benign
Transcript: ENSMUST00000128119
AA Change: P274S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: P274S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
R7699:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
R7700:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCACTTGTGGGAGAACCAGGG -3'
(R):5'- GGGATGGAGGCCAAGCTATCAGTC -3'

Sequencing Primer
(F):5'- GCACAGTGTGAGTGCCG -3'
(R):5'- ggaagggagggagggag -3'
Posted On2013-06-11