Incidental Mutation 'R0561:Ctnnb1'
ID45881
Institutional Source Beutler Lab
Gene Symbol Ctnnb1
Ensembl Gene ENSMUSG00000006932
Gene Namecatenin (cadherin associated protein), beta 1
Synonymsbeta-catenin, Catnb, beta catenin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120929216-120960507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120951722 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 291 (V291M)
Ref Sequence ENSEMBL: ENSMUSP00000136294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130466] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000163844] [ENSMUST00000178812]
Predicted Effect probably damaging
Transcript: ENSMUST00000007130
AA Change: V291M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: V291M

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126633
Predicted Effect probably benign
Transcript: ENSMUST00000130466
Predicted Effect probably benign
Transcript: ENSMUST00000130845
SMART Domains Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 80 2e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133689
SMART Domains Protein: ENSMUSP00000128564
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 41 2e-20 BLAST
Pfam:Arm 42 82 4.4e-9 PFAM
Blast:ARM 83 123 9e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145093
SMART Domains Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 174 1e-113 PDB
SCOP:d1gw5a_ 90 172 5e-8 SMART
Blast:ARM 141 174 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154356
AA Change: V291M

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: V291M

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 562 3e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156911
Predicted Effect probably benign
Transcript: ENSMUST00000163844
SMART Domains Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 72 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169931
SMART Domains Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
ARM 2 36 3.8e1 SMART
ARM 41 82 7.34e-3 SMART
ARM 83 144 1.92e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000170729
AA Change: R102H
SMART Domains Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932
AA Change: R102H

DomainStartEndE-ValueType
Blast:ARM 2 35 4e-15 BLAST
PDB:3SLA|E 2 87 1e-57 PDB
SCOP:d1jdha_ 2 89 2e-12 SMART
Blast:ARM 36 78 2e-23 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178812
AA Change: V291M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: V291M

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Ctnnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0092:Ctnnb1 UTSW 9 120952863 missense possibly damaging 0.78
R0326:Ctnnb1 UTSW 9 120951712 missense probably benign 0.01
R1017:Ctnnb1 UTSW 9 120950728 missense probably damaging 0.99
R1918:Ctnnb1 UTSW 9 120951034 missense possibly damaging 0.80
R3892:Ctnnb1 UTSW 9 120950514 splice site probably benign
R3915:Ctnnb1 UTSW 9 120955651 missense probably benign 0.00
R4869:Ctnnb1 UTSW 9 120952994 missense possibly damaging 0.93
R5707:Ctnnb1 UTSW 9 120955168 missense probably benign 0.01
R6744:Ctnnb1 UTSW 9 120952959 missense probably damaging 0.99
R7466:Ctnnb1 UTSW 9 120955416 missense probably damaging 1.00
R7707:Ctnnb1 UTSW 9 120952865 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGGACTCTGCACAACCTTTCTCAC -3'
(R):5'- CCCTTCAATGCTTAGCACCGTACTG -3'

Sequencing Primer
(F):5'- ATCTTTAAGTCTGGTGGCATCC -3'
(R):5'- ATGCTTAGCACCGTACTGTACAC -3'
Posted On2013-06-11