Incidental Mutation 'Z1088:Psg25'
ID 458828
Institutional Source Beutler Lab
Gene Symbol Psg25
Ensembl Gene ENSMUSG00000070798
Gene Name pregnancy-specific beta-1-glycoprotein 25
Synonyms cea13
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # Z1088 ()
Quality Score 156
Status Not validated
Chromosome 7
Chromosomal Location 18253627-18266191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18263516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 102 (R102S)
Ref Sequence ENSEMBL: ENSMUSP00000092389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094795]
AlphaFold Q497W1
Predicted Effect probably benign
Transcript: ENSMUST00000094795
AA Change: R102S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092389
Gene: ENSMUSG00000070798
AA Change: R102S

DomainStartEndE-ValueType
IG 40 141 2.15e-3 SMART
IG 160 261 1.55e0 SMART
IG 280 381 3.59e-5 SMART
IGc2 397 461 1.02e-9 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.2%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 1506 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik T C 6: 32,035,427 (GRCm39) W36R probably damaging Het
1700016H13Rik G A 5: 103,797,434 (GRCm39) P25L probably damaging Het
1700017N19Rik A T 10: 100,441,501 (GRCm39) K170M probably damaging Het
1700020A23Rik C T 2: 130,247,772 (GRCm39) P77L probably damaging Het
1700020L24Rik A G 11: 83,331,332 (GRCm39) Q81R probably damaging Het
2210408I21Rik A C 13: 77,323,010 (GRCm39) D13A probably damaging Het
2310003L06Rik G T 5: 88,120,165 (GRCm39) Q307H probably damaging Het
2510039O18Rik G A 4: 148,029,202 (GRCm39) E391K probably benign Het
4930447C04Rik G C 12: 72,986,169 (GRCm39) probably benign Het
4932438H23Rik T A 16: 90,852,701 (GRCm39) H145L probably benign Het
4933405L10Rik G A 8: 106,436,395 (GRCm39) G197E probably damaging Het
A4gnt C T 9: 99,495,894 (GRCm39) S110L probably damaging Het
Aadacl4fm1 C A 4: 144,255,239 (GRCm39) L220M probably damaging Het
Aasdh T C 5: 77,049,004 (GRCm39) probably null Het
Abca13 A C 11: 9,244,687 (GRCm39) Q2183H probably damaging Het
Abca14 T A 7: 119,815,358 (GRCm39) I202N probably benign Het
Abca17 T A 17: 24,498,053 (GRCm39) K1428M probably damaging Het
Abca17 C G 17: 24,565,193 (GRCm39) A80P probably damaging Het
Abca17 G T 17: 24,498,081 (GRCm39) P1419T probably benign Het
Abca8b A T 11: 109,867,308 (GRCm39) M250K probably benign Het
Abcc1 C A 16: 14,228,673 (GRCm39) H307N probably benign Het
Abcc12 G A 8: 87,286,908 (GRCm39) probably null Het
Abcc8 A G 7: 45,787,489 (GRCm39) F571L probably benign Het
Abhd8 G A 8: 71,914,445 (GRCm39) P61L probably benign Het
Abtb3 C T 10: 85,223,721 (GRCm39) H177Y probably benign Het
Acan G T 7: 78,737,948 (GRCm39) E218* probably null Het
Acan A C 7: 78,761,102 (GRCm39) H1938P probably benign Het
Acan G C 7: 78,749,858 (GRCm39) S1543T probably benign Het
Accsl A C 2: 93,696,293 (GRCm39) F106V probably benign Het
Acnat1 T G 4: 49,447,588 (GRCm39) K313T probably damaging Het
Acot8 T C 2: 164,641,733 (GRCm39) Q133R probably damaging Het
Acox3 A T 5: 35,745,566 (GRCm39) K18M probably damaging Het
Acoxl A C 2: 127,714,115 (GRCm39) D137A probably damaging Het
Acsm5 A T 7: 119,136,434 (GRCm39) K335M probably damaging Het
Actn4 A C 7: 28,594,003 (GRCm39) F855V probably damaging Het
Acvr2a T C 2: 48,760,385 (GRCm39) V47A probably benign Het
Ada C G 2: 163,570,036 (GRCm39) probably null Het
Adam21 G A 12: 81,607,460 (GRCm39) H101Y probably damaging Het
Adam26a T A 8: 44,022,735 (GRCm39) N252Y probably damaging Het
Adam26b T C 8: 43,973,634 (GRCm39) E456G probably damaging Het
Adam3 C A 8: 25,171,447 (GRCm39) probably benign Het
Adamts14 A G 10: 61,054,224 (GRCm39) F603L probably damaging Het
Adamts18 T C 8: 114,502,072 (GRCm39) K263R possibly damaging Het
Adamts3 G A 5: 89,832,308 (GRCm39) R932C probably damaging Het
Adamtsl3 T C 7: 82,189,533 (GRCm39) S586P probably damaging Het
Adamtsl3 T G 7: 82,148,922 (GRCm39) F319V probably damaging Het
Adcy1 G C 11: 7,100,019 (GRCm39) A710P probably benign Het
Adcy4 G A 14: 56,018,413 (GRCm39) A178V probably benign Het
Add1 T A 5: 34,770,744 (GRCm39) L285* probably null Het
Add2 G C 6: 86,062,947 (GRCm39) R35P probably damaging Het
Adgrb3 C T 1: 25,170,352 (GRCm39) R982H probably damaging Het
Adgrf3 T G 5: 30,404,118 (GRCm39) K378T possibly damaging Het
Adgrl3 A T 5: 81,660,005 (GRCm39) D258V probably damaging Het
Adgrl3 C A 5: 81,477,729 (GRCm39) H61N probably benign Het
Adgrl4 C A 3: 151,205,812 (GRCm39) P175T probably benign Het
Adgrv1 G A 13: 81,624,791 (GRCm39) P3726L probably damaging Het
Adra1a T G 14: 66,964,945 (GRCm39) F312V probably damaging Het
Adrm1b A G 3: 92,336,397 (GRCm39) S102P probably damaging Het
Aebp1 C T 11: 5,821,460 (GRCm39) R620* probably null Het
Afdn G A 17: 14,104,042 (GRCm39) S1126N probably damaging Het
Afg3l1 A C 8: 124,214,981 (GRCm39) E216D possibly damaging Het
Afp G C 5: 90,652,874 (GRCm39) G448A possibly damaging Het
Agap2 G T 10: 126,924,111 (GRCm39) S775I unknown Het
Agbl1 T G 7: 76,069,652 (GRCm39) F143V probably benign Het
Ahnak A T 19: 8,993,446 (GRCm39) N4910I probably damaging Het
Ak1 A T 2: 32,520,283 (GRCm39) K27M probably damaging Het
Aldh1b1 C T 4: 45,802,540 (GRCm39) A26V probably benign Het
Aldh1b1 G C 4: 45,802,539 (GRCm39) A26P probably benign Het
Alk C G 17: 72,512,802 (GRCm39) G386R probably damaging Het
Amn C T 12: 111,242,117 (GRCm39) A368V probably benign Het
Amotl2 TCC TC 9: 102,600,897 (GRCm39) probably null Het
Ampd3 T G 7: 110,377,032 (GRCm39) L8V probably damaging Het
Anapc2 G T 2: 25,163,380 (GRCm39) G206* probably null Het
Angel2 G A 1: 190,669,751 (GRCm39) D144N probably damaging Het
Angptl3 A G 4: 98,922,757 (GRCm39) N266S probably benign Het
Ank2 A G 3: 126,823,158 (GRCm39) V397A possibly damaging Het
Ankib1 C A 5: 3,763,137 (GRCm39) E531* probably null Het
Ankib1 T A 5: 3,763,136 (GRCm39) E531V probably damaging Het
Ankrd16 CCTCCGGTACTT C 2: 11,784,629 (GRCm39) probably null Het
Ankrd24 G A 10: 81,474,490 (GRCm39) G74D probably damaging Het
Ankrd44 A C 1: 54,698,141 (GRCm39) L606R probably damaging Het
Ankrd50 T G 3: 38,511,314 (GRCm39) K351T probably damaging Het
Anks4b G A 7: 119,781,742 (GRCm39) D258N probably benign Het
Anln T C 9: 22,274,097 (GRCm39) E580G probably benign Het
Ano3 G A 2: 110,576,192 (GRCm39) L454F probably damaging Het
Antxrl A T 14: 33,789,928 (GRCm39) N340I probably damaging Het
Anxa10 C T 8: 62,545,540 (GRCm39) G64D probably damaging Het
Aox1 G A 1: 58,120,701 (GRCm39) V865M probably benign Het
Ap3d1 T C 10: 80,555,071 (GRCm39) Y418C possibly damaging Het
Ap5b1 A C 19: 5,620,452 (GRCm39) K624T possibly damaging Het
Apbb1 C T 7: 105,208,343 (GRCm39) C654Y probably damaging Het
Apbb2 T G 5: 66,460,039 (GRCm39) K710T probably damaging Het
Apc C T 18: 34,446,220 (GRCm39) Q1021* probably null Het
Apcdd1 T G 18: 63,070,254 (GRCm39) F174V probably benign Het
Apob A G 12: 8,062,936 (GRCm39) N193S possibly damaging Het
Apob C A 12: 8,055,074 (GRCm39) L1358I possibly damaging Het
Apob A T 12: 8,055,945 (GRCm39) K1476* probably null Het
Apobr G A 7: 126,184,203 (GRCm39) R7H probably benign Het
Apol11b A C 15: 77,522,207 (GRCm39) I30R probably benign Het
Arfgef2 A T 2: 166,735,515 (GRCm39) T1727S possibly damaging Het
Arfip2 G C 7: 105,286,449 (GRCm39) L188V probably damaging Het
Arhgap11a A G 2: 113,673,239 (GRCm39) C115R probably damaging Het
Arhgap18 A T 10: 26,726,000 (GRCm39) probably null Het
Arhgap26 G C 18: 39,490,724 (GRCm39) probably benign Het
Arhgap28 G A 17: 68,168,272 (GRCm39) A465V possibly damaging Het
Arhgdib C A 6: 136,910,616 (GRCm39) K48N probably damaging Het
Arhgef10 C G 8: 15,014,191 (GRCm39) A364G probably benign Het
Arhgef10l G C 4: 140,309,046 (GRCm39) L17V possibly damaging Het
Arhgef18 C T 8: 3,489,628 (GRCm39) S320F probably damaging Het
Arhgef28 G A 13: 98,082,199 (GRCm39) R1203W probably damaging Het
Arl5b G A 2: 15,079,832 (GRCm39) M134I probably benign Het
Armc1 C A 3: 19,203,671 (GRCm39) S85I probably damaging Het
Armc12 A G 17: 28,751,033 (GRCm39) E83G probably benign Het
Armh1 C T 4: 117,070,992 (GRCm39) D378N probably benign Het
Armh3 T C 19: 45,807,344 (GRCm39) E684G probably damaging Het
Arsj G T 3: 126,232,781 (GRCm39) R509M possibly damaging Het
Arvcf G A 16: 18,221,391 (GRCm39) R602H probably damaging Het
Asb14 A G 14: 26,625,305 (GRCm39) K220R probably benign Het
Ascc2 C G 11: 4,596,656 (GRCm39) A59G probably benign Het
Asf1b G C 8: 84,695,781 (GRCm39) A141P possibly damaging Het
Ash1l C A 3: 88,890,016 (GRCm39) L632I probably benign Het
Asph T A 4: 9,630,715 (GRCm39) N211I possibly damaging Het
Astn1 G A 1: 158,424,776 (GRCm39) R646H possibly damaging Het
Astn1 C A 1: 158,511,666 (GRCm39) Y1169* probably null Het
Astn1 C A 1: 158,300,067 (GRCm39) P136T possibly damaging Het
Asxl3 A C 18: 22,649,829 (GRCm39) K606T probably benign Het
Atf7 C G 15: 102,455,617 (GRCm39) G249A probably benign Het
Atg14 C G 14: 47,805,749 (GRCm39) A39P probably damaging Het
Atg7 T A 6: 114,672,647 (GRCm39) F205I probably benign Het
Atm T G 9: 53,442,987 (GRCm39) K92T probably damaging Het
Atp11b G T 3: 35,866,362 (GRCm39) G387V probably damaging Het
Atp12a G A 14: 56,623,598 (GRCm39) V879I probably benign Het
Atp13a5 T G 16: 29,100,880 (GRCm39) K681N probably benign Het
Atp2b2 A C 6: 113,819,267 (GRCm39) F9V probably damaging Het
Atp6v1h A C 1: 5,168,271 (GRCm39) K147T probably damaging Het
Atp8a2 T G 14: 60,265,419 (GRCm39) S306R probably benign Het
Atp8b2 T C 3: 89,861,875 (GRCm39) K226R probably damaging Het
Atr A G 9: 95,767,373 (GRCm39) probably null Het
Atrn G A 2: 130,815,319 (GRCm39) S745N probably benign Het
Auts2 T G 5: 131,505,392 (GRCm39) probably benign Het
Avpr1a G C 10: 122,285,482 (GRCm39) S258T probably benign Het
AW551984 C A 9: 39,501,899 (GRCm39) E736* probably null Het
B3galt6 C A 4: 156,076,391 (GRCm39) R228L probably benign Het
B3gnt3 G A 8: 72,146,409 (GRCm39) S40F possibly damaging Het
B3gnt8 C T 7: 25,327,575 (GRCm39) R2C probably damaging Het
Barx2 G A 9: 31,758,162 (GRCm39) P259S possibly damaging Het
Baz2b T A 2: 59,790,359 (GRCm39) E618V probably damaging Het
BC016579 C T 16: 45,474,311 (GRCm39) D32N probably benign Het
BC051665 T G 13: 60,932,457 (GRCm39) E76A probably benign Het
Bcl9 G T 3: 97,117,957 (GRCm39) Q246K possibly damaging Het
Best3 C T 10: 116,860,075 (GRCm39) S445L probably benign Het
Bfar C T 16: 13,515,324 (GRCm39) P304L probably damaging Het
Birc6 A C 17: 74,918,537 (GRCm39) E1932D probably damaging Het
Bltp1 A C 3: 37,041,716 (GRCm39) E2698A probably damaging Het
Bod1l C T 5: 41,978,489 (GRCm39) E942K probably damaging Het
Bod1l C G 5: 41,966,107 (GRCm39) V2653L possibly damaging Het
Bptf A C 11: 106,965,408 (GRCm39) V1147G probably benign Het
Braf A G 6: 39,638,960 (GRCm39) C264R probably damaging Het
Brca2 A T 5: 150,466,228 (GRCm39) K1997N probably damaging Het
Brf2 T G 8: 27,614,019 (GRCm39) E389A probably damaging Het
Brinp2 G A 1: 158,074,559 (GRCm39) R521* probably null Het
Brsk1 C T 7: 4,710,371 (GRCm39) T460M possibly damaging Het
Brwd3 A T X: 107,818,466 (GRCm39) V732E probably damaging Het
Btaf1 T A 19: 36,964,018 (GRCm39) V863D probably damaging Het
C1rl C A 6: 124,485,701 (GRCm39) D357E probably benign Het
Cacna1b T A 2: 24,551,856 (GRCm39) K1096M probably damaging Het
Cacna1b T A 2: 24,623,957 (GRCm39) S208C probably damaging Het
Cacna1f C G X: 7,476,490 (GRCm39) L144V probably damaging Het
Cacna2d1 A C 5: 16,399,761 (GRCm39) E121D probably benign Het
Cacna2d3 G T 14: 28,786,265 (GRCm39) A574D probably damaging Het
Cadps C A 14: 12,467,113 (GRCm38) D935Y probably damaging Het
Camk2a T G 18: 61,076,222 (GRCm39) probably benign Het
Capn15 C T 17: 26,182,321 (GRCm39) E530K probably damaging Het
Carmil1 G A 13: 24,228,165 (GRCm39) Q600* probably null Het
Carmil3 C T 14: 55,739,025 (GRCm39) T893M probably damaging Het
Casp12 C T 9: 5,354,582 (GRCm39) A317V possibly damaging Het
Casp9 T G 4: 141,532,772 (GRCm39) L223V probably benign Het
Casz1 T C 4: 149,028,816 (GRCm39) L1087P probably benign Het
Catsper3 T G 13: 55,955,917 (GRCm39) F328V probably damaging Het
Cavin1 T C 11: 100,849,484 (GRCm39) D382G probably damaging Het
Ccdc116 C A 16: 16,965,035 (GRCm39) probably benign Het
Ccdc14 G A 16: 34,511,174 (GRCm39) M1I probably null Het
Ccdc141 T G 2: 76,958,616 (GRCm39) E161D probably benign Het
Ccdc175 G T 12: 72,175,153 (GRCm39) H507N probably benign Het
Ccdc24 C T 4: 117,728,260 (GRCm39) probably null Het
Ccdc83 T C 7: 89,893,254 (GRCm39) K168E probably damaging Het
Ccdc87 A G 19: 4,890,750 (GRCm39) K414R probably benign Het
Ccr1l1 T G 9: 123,777,887 (GRCm39) I187L probably benign Het
Cd209a G T 8: 3,797,017 (GRCm39) S80Y probably damaging Het
Cd2ap G A 17: 43,118,884 (GRCm39) T518I probably benign Het
Cd300lb A C 11: 114,816,860 (GRCm39) L61V probably damaging Het
Cd36 T A 5: 18,000,573 (GRCm39) probably null Het
Cd40 A T 2: 164,904,960 (GRCm39) K92M probably damaging Het
Cd48 A T 1: 171,523,295 (GRCm39) D46V possibly damaging Het
Cd55 T G 1: 130,380,216 (GRCm39) D254A probably benign Het
Cd59b G C 2: 103,911,348 (GRCm39) S23T possibly damaging Het
Cd8a T C 6: 71,350,670 (GRCm39) L45P possibly damaging Het
Cd93 T A 2: 148,284,284 (GRCm39) D354V probably benign Het
Cd99l2 G T X: 70,484,694 (GRCm39) P63Q probably damaging Het
Cd99l2 C T X: 70,484,752 (GRCm39) probably null Het
Cdan1 T C 2: 120,560,817 (GRCm39) S251G probably damaging Het
Cdca2 G C 14: 67,937,747 (GRCm39) T302S probably benign Het
Cdca7l A G 12: 117,836,146 (GRCm39) M206V possibly damaging Het
Cdcp3 T C 7: 130,848,362 (GRCm39) C839R probably damaging Het
Cdh20 C G 1: 110,012,853 (GRCm39) I395M probably benign Het
Cdh22 T C 2: 164,954,350 (GRCm39) S724G probably benign Het
Cdh23 T C 10: 60,249,423 (GRCm39) T832A probably benign Het
Cdh8 G T 8: 100,006,134 (GRCm39) S151Y probably damaging Het
Cdk11b G T 4: 155,726,021 (GRCm39) probably benign Het
Cdkal1 G C 13: 29,961,219 (GRCm39) H117D probably damaging Het
Cdr1 T G X: 60,227,710 (GRCm39) E485D possibly damaging Het
Celf4 G C 18: 25,629,306 (GRCm39) P406A probably benign Het
Celf5 C T 10: 81,302,783 (GRCm39) A301T probably damaging Het
Celsr2 T A 3: 108,321,433 (GRCm39) S460C probably damaging Het
Cenpf A C 1: 189,385,128 (GRCm39) L2384R probably damaging Het
Cenpp T C 13: 49,801,134 (GRCm39) probably null Het
Ces1a T G 8: 93,752,235 (GRCm39) K374T probably benign Het
Ces1b T C 8: 93,791,594 (GRCm39) E335G probably damaging Het
Ces1d T C 8: 93,901,736 (GRCm39) K411R probably benign Het
Ces1e T C 8: 93,937,046 (GRCm39) T342A probably benign Het
Ces2e A C 8: 105,657,979 (GRCm39) K359T probably benign Het
Ces2e A G 8: 105,659,030 (GRCm39) probably null Het
Cfap44 G T 16: 44,221,829 (GRCm39) R14I probably damaging Het
Cfap46 C T 7: 139,214,980 (GRCm39) G1582R probably damaging Het
Cfap47 C A X: 78,374,419 (GRCm39) L2544F probably damaging Het
Cfap47 A T X: 78,374,420 (GRCm39) L2544* probably null Het
Cfap57 C T 4: 118,439,079 (GRCm39) D816N probably benign Het
Cfap61 C T 2: 145,971,147 (GRCm39) P919L probably benign Het
Cfh A G 1: 140,036,642 (GRCm39) L636P probably benign Het
Cfh G A 1: 140,075,456 (GRCm39) P243S possibly damaging Het
Cfhr4 T A 1: 139,681,999 (GRCm39) Q199L probably damaging Het
Chd6 T C 2: 160,808,408 (GRCm39) D1602G probably damaging Het
Chi3l1 A G 1: 134,117,238 (GRCm39) K345R probably benign Het
Chrd T C 16: 20,560,005 (GRCm39) F891L probably damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cilp2 C G 8: 70,338,060 (GRCm39) K190N possibly damaging Het
Cit A T 5: 116,123,592 (GRCm39) S1421C possibly damaging Het
Clca3a1 T G 3: 144,452,714 (GRCm39) S590R probably damaging Het
Clcn1 C A 6: 42,277,294 (GRCm39) L462I probably benign Het
Clcn1 A C 6: 42,284,190 (GRCm39) K514T probably damaging Het
Cldn4 G A 5: 134,975,452 (GRCm39) L50F probably damaging Het
Clec4g T G 8: 3,766,548 (GRCm39) N251T probably damaging Het
Clec4g A C 8: 3,757,796 (GRCm39) probably benign Het
Clu A C 14: 66,214,362 (GRCm39) E278D probably benign Het
Cmya5 C G 13: 93,200,087 (GRCm39) A3414P probably benign Het
CN725425 T G 15: 91,129,965 (GRCm39) F276C possibly damaging Het
Cnksr2 T G X: 156,636,216 (GRCm39) N854T probably benign Het
Cnot7 ATTTATTTTTTA ATTTA 8: 40,953,780 (GRCm39) probably benign Het
Cnst G C 1: 179,407,130 (GRCm39) G59A probably damaging Het
Cntn3 A G 6: 102,397,255 (GRCm39) L106P possibly damaging Het
Cntnap4 C G 8: 113,542,152 (GRCm39) P762A probably damaging Het
Cntnap5a G A 1: 115,987,981 (GRCm39) A171T probably benign Het
Col17a1 A G 19: 47,640,617 (GRCm39) S994P possibly damaging Het
Col19a1 A C 1: 24,319,021 (GRCm39) I1023S probably damaging Het
Col4a1 T G 8: 11,296,859 (GRCm39) probably benign Het
Col4a4 A C 1: 82,430,917 (GRCm39) L1662V unknown Het
Col6a1 C G 10: 76,545,393 (GRCm39) *1026Y probably null Het
Col6a5 A C 9: 105,803,266 (GRCm39) I1233S unknown Het
Col7a1 C T 9: 108,807,568 (GRCm39) silent Het
Colec12 A G 18: 9,848,727 (GRCm39) T302A probably benign Het
Commd4 T C 9: 57,063,540 (GRCm39) S73G probably benign Het
Coro1c A G 5: 113,988,710 (GRCm39) probably null Het
Cpd C A 11: 76,692,572 (GRCm39) C755F probably damaging Het
Cpsf6 T C 10: 117,191,946 (GRCm39) D518G unknown Het
Creb3l4 C T 3: 90,145,058 (GRCm39) V365M possibly damaging Het
Crhr2 A G 6: 55,080,201 (GRCm39) V126A possibly damaging Het
Crim1 G T 17: 78,675,264 (GRCm39) K824N probably benign Het
Crispld1 A G 1: 17,834,300 (GRCm39) T489A probably benign Het
Crybg1 C T 10: 43,873,307 (GRCm39) R1267H probably benign Het
Cryzl2 G T 1: 157,293,359 (GRCm39) L153F probably benign Het
Csgalnact1 T C 8: 68,853,982 (GRCm39) K273R probably damaging Het
Csmd1 T G 8: 16,239,992 (GRCm39) K1140T possibly damaging Het
Csmd1 G T 8: 16,250,072 (GRCm39) Q969K probably damaging Het
Csmd1 T C 8: 16,396,631 (GRCm39) D433G probably damaging Het
Csmd1 C T 8: 16,142,272 (GRCm39) D1544N probably damaging Het
Csmd1 G T 8: 15,971,875 (GRCm39) T2985N possibly damaging Het
Csmd3 G A 15: 47,499,789 (GRCm39) L3027F probably damaging Het
Csmd3 G A 15: 47,710,677 (GRCm39) P1637S probably damaging Het
Csn2 T G 5: 87,843,868 (GRCm39) probably benign Het
Cspg4 C A 9: 56,793,320 (GRCm39) L352M probably damaging Het
Cspp1 C G 1: 10,153,771 (GRCm39) D393E possibly damaging Het
Ctcfl G A 2: 172,960,137 (GRCm39) H149Y probably benign Het
Ctnna3 C T 10: 63,417,757 (GRCm39) S165F probably benign Het
Ctnnd2 A C 15: 30,966,959 (GRCm39) N970T probably benign Het
Ctr9 T C 7: 110,629,431 (GRCm39) L19P probably damaging Het
Ctsd C T 7: 141,930,334 (GRCm39) G403S probably damaging Het
Cubn G A 2: 13,299,040 (GRCm39) S3211L probably benign Het
Cul3 A G 1: 80,267,808 (GRCm39) V177A probably benign Het
Cxcl16 C T 11: 70,346,804 (GRCm39) G113E probably damaging Het
Cyfip1 A C 7: 55,524,800 (GRCm39) K144T probably damaging Het
Cyp2a12 A G 7: 26,734,845 (GRCm39) K422R possibly damaging Het
Cyp2a5 G T 7: 26,540,532 (GRCm39) D69Y probably damaging Het
Cyp2b23 C G 7: 26,380,836 (GRCm39) A130P probably benign Het
Cyp2c50 C T 19: 40,086,399 (GRCm39) A321V possibly damaging Homo
Cyp2c68 C T 19: 39,727,907 (GRCm39) A82T probably damaging Het
Cyp2d11 C A 15: 82,274,312 (GRCm39) M356I probably damaging Het
Cyp2r1 C T 7: 114,151,209 (GRCm39) R370K probably damaging Het
Cyp2t4 G C 7: 26,857,171 (GRCm39) G345R probably damaging Het
Cyp3a59 A C 5: 146,035,032 (GRCm39) N237H probably benign Het
Cyp4a29 T G 4: 115,105,693 (GRCm39) F132V probably benign Het
Cyp4f15 G C 17: 32,911,664 (GRCm39) probably null Het
Cyp4f40 G A 17: 32,892,976 (GRCm39) probably null Het
D030056L22Rik A T 19: 18,694,679 (GRCm39) S145C possibly damaging Het
D7Ertd443e T G 7: 133,896,711 (GRCm39) S154R probably benign Het
Dab1 A C 4: 104,336,429 (GRCm39) Q8H probably damaging Het
Dag1 G C 9: 108,085,867 (GRCm39) P425A possibly damaging Het
Dapk2 T C 9: 66,153,759 (GRCm39) F172L possibly damaging Het
Daw1 A T 1: 83,183,685 (GRCm39) K245M probably null Het
Dbnl A T 11: 5,746,797 (GRCm39) K176* probably null Het
Dcaf13 C T 15: 39,008,642 (GRCm39) R415C probably damaging Het
Dcaf15 A C 8: 84,829,410 (GRCm39) W111G probably damaging Het
Dcaf8l A G X: 88,449,943 (GRCm39) V62A probably benign Het
Dclk1 G T 3: 55,407,526 (GRCm39) G235V probably damaging Het
Dclre1c G T 2: 3,439,117 (GRCm39) E92D possibly damaging Het
Dda1 C G 8: 71,927,139 (GRCm39) A4G probably damaging Het
Ddb1 C A 19: 10,596,594 (GRCm39) L438I probably damaging Het
Ddit4l G C 3: 137,332,123 (GRCm39) G163A probably benign Het
Ddn T C 15: 98,704,020 (GRCm39) E424G possibly damaging Het
Ddx19b T G 8: 111,742,207 (GRCm39) K176T probably benign Het
Ddx23 A G 15: 98,545,502 (GRCm39) V602A probably benign Het
Ddx59 A C 1: 136,360,189 (GRCm39) N401T possibly damaging Het
Def8 A G 8: 124,183,237 (GRCm39) R279G probably damaging Het
Defb14 G T 8: 19,245,200 (GRCm39) G59V probably damaging Het
Defb8 A C 8: 19,497,557 (GRCm39) L18R possibly damaging Het
Defb9 A C 8: 22,371,883 (GRCm39) F43L probably benign Het
Dennd1a A G 2: 37,690,704 (GRCm39) S799P probably benign Het
Dennd2d C T 3: 106,407,190 (GRCm39) R414* probably null Het
Dennd4a G A 9: 64,779,304 (GRCm39) A596T probably damaging Het
Dennd5a T G 7: 109,493,954 (GRCm39) D1250A possibly damaging Het
Dennd5a T C 7: 109,504,480 (GRCm39) K854E probably damaging Het
Dera T G 6: 137,814,116 (GRCm39) I99M possibly damaging Het
Desi2 A G 1: 178,015,510 (GRCm39) N10S probably benign Het
Dgkg T G 16: 22,288,078 (GRCm39) N763T probably damaging Het
Dgkg A T 16: 22,391,436 (GRCm39) S341T probably benign Het
Dhh T C 15: 98,792,790 (GRCm39) N157D probably benign Het
Dhtkd1 C A 2: 5,916,685 (GRCm39) A664S possibly damaging Het
Dhx37 T C 5: 125,493,655 (GRCm39) E968G possibly damaging Het
Dhx57 A C 17: 80,558,777 (GRCm39) L1061V probably damaging Het
Dip2a T C 10: 76,121,462 (GRCm39) K798R probably benign Het
Disp3 G C 4: 148,356,200 (GRCm39) A220G possibly damaging Het
Dlg4 G A 11: 69,921,956 (GRCm39) R66Q probably damaging Het
Dlg5 G A 14: 24,208,162 (GRCm39) P992S probably damaging Het
Dlgap2 C G 8: 14,872,472 (GRCm39) A651G probably benign Het
Dlx5 C A 6: 6,879,607 (GRCm39) Q153H probably damaging Het
Dmd A G X: 83,619,366 (GRCm39) T2614A probably benign Het
Dmd C T X: 82,922,101 (GRCm39) S1457F possibly damaging Het
Dmrt2 T G 19: 25,656,006 (GRCm39) L535R probably damaging Het
Dmxl1 A G 18: 50,054,032 (GRCm39) N2546S probably benign Het
Dnaaf3 G A 7: 4,526,794 (GRCm39) R428W probably damaging Het
Dnah1 T G 14: 31,026,768 (GRCm39) K752T probably benign Het
Dnah11 C A 12: 117,946,704 (GRCm39) A3127S probably damaging Het
Dnah11 G C 12: 117,858,747 (GRCm39) T4121R probably damaging Het
Dnah2 A C 11: 69,321,619 (GRCm39) L3847R probably damaging Het
Dnah3 T A 7: 119,685,520 (GRCm39) D164V probably benign Het
Dnah3 T C 7: 119,610,096 (GRCm39) K1769R probably null Het
Dnah5 G A 15: 28,366,503 (GRCm39) G2739S probably null Het
Dnah5 A C 15: 28,384,376 (GRCm39) D3040A probably damaging Het
Dnah7a A C 1: 53,507,802 (GRCm39) Y3090D probably damaging Het
Dnajb12 C A 10: 59,725,876 (GRCm39) P54T probably benign Het
Dnajb8 G A 6: 88,199,827 (GRCm39) G121D probably benign Het
Dnajc6 G A 4: 101,496,526 (GRCm39) V830M probably damaging Het
Dnhd1 C G 7: 105,361,934 (GRCm39) T3664S probably benign Het
Dnmbp G A 19: 43,863,423 (GRCm39) A453V probably benign Het
Dnmbp G A 19: 43,890,561 (GRCm39) P402L probably benign Het
Dock1 A G 7: 134,406,276 (GRCm39) Y760C probably damaging Het
Dock10 T C 1: 80,510,064 (GRCm39) K1588R probably damaging Het
Dock11 A G X: 35,266,186 (GRCm39) K718R probably benign Het
Dock2 C A 11: 34,586,039 (GRCm39) E548* probably null Het
Dock2 A C 11: 34,583,209 (GRCm39) L568R probably damaging Het
Dock2 G A 11: 34,388,300 (GRCm39) T211M probably benign Het
Dock9 C T 14: 121,792,687 (GRCm39) V1844M probably damaging Het
Dop1b C T 16: 93,560,214 (GRCm39) T720I probably benign Het
Dpf2 A C 19: 5,952,472 (GRCm39) F289V probably damaging Het
Dpy19l2 C T 9: 24,572,120 (GRCm39) probably null Het
Dsc2 C T 18: 20,179,361 (GRCm39) E236K probably damaging Het
Dscam A C 16: 96,573,761 (GRCm39) F734V probably benign Het
Dscc1 A C 15: 54,943,713 (GRCm39) S386A possibly damaging Het
Duxf4 T G 10: 58,071,733 (GRCm39) E160D probably damaging Het
Dync1h1 GAAA GAA 12: 110,596,351 (GRCm39) probably null Het
Dyrk3 A G 1: 131,056,970 (GRCm39) L401P probably damaging Het
Ecm1 T C 3: 95,642,188 (GRCm39) I466V probably benign Het
Eef2 G C 10: 81,017,723 (GRCm39) G795A probably damaging Het
Efcab3 A C 11: 104,642,728 (GRCm39) K1117T probably damaging Het
Efcab6 A C 15: 83,839,210 (GRCm39) L383R probably damaging Het
Efl1 A C 7: 82,342,058 (GRCm39) S489R probably benign Het
Egfl8 C A 17: 34,833,215 (GRCm39) G177V probably damaging Het
Ehbp1l1 G C 19: 5,766,315 (GRCm39) P399A possibly damaging Het
Ehd2 G C 7: 15,697,391 (GRCm39) A139G possibly damaging Het
Eif1ad3 A C 12: 87,843,704 (GRCm39) E117A possibly damaging Het
Eif3j1 T G 2: 121,881,094 (GRCm39) F182C probably damaging Het
Eif3k T C 7: 28,674,024 (GRCm39) probably null Het
Eif3m A C 2: 104,843,601 (GRCm39) L127R probably damaging Het
Elac1 T G 18: 73,872,161 (GRCm39) D278A probably benign Het
Ell2 TCTAGGTGGCC TC 13: 75,909,992 (GRCm39) probably benign Het
Elmod1 A C 9: 53,826,898 (GRCm39) S263A probably benign Het
Eme2 T A 17: 25,113,541 (GRCm39) probably null Het
Eml1 T G 12: 108,503,718 (GRCm39) F772V possibly damaging Het
Emsy G A 7: 98,249,929 (GRCm39) P786L probably damaging Het
Epb41l3 T G 17: 69,560,517 (GRCm39) F355V probably damaging Het
Epg5 C G 18: 78,002,354 (GRCm39) A591G probably benign Het
Epha4 A C 1: 77,483,299 (GRCm39) S237A possibly damaging Het
Epha5 G C 5: 84,385,381 (GRCm39) H317D probably benign Het
Ephb1 C T 9: 101,861,344 (GRCm39) V607I probably damaging Het
Ephx2 A G 14: 66,344,767 (GRCm39) F168L probably benign Het
Eps15l1 T G 8: 73,140,745 (GRCm39) N249T probably damaging Het
Ercc6l2 A G 13: 64,001,542 (GRCm39) E567G possibly damaging Het
Ermp1 G C 19: 29,590,325 (GRCm39) S792R probably damaging Het
Esp8 A G 17: 40,840,936 (GRCm39) T66A possibly damaging Het
Esr1 C G 10: 4,662,667 (GRCm39) A95G possibly damaging Het
Esrrg A T 1: 187,882,415 (GRCm39) E224V probably benign Het
Etaa1 T C 11: 17,896,465 (GRCm39) T551A possibly damaging Het
Etv5 C T 16: 22,202,339 (GRCm39) E472K probably benign Het
Eva1a TGCAGCGACAGCAGCGACAGC TGCAGCGACAGCAGCGACAGCAGCGACAGC 6: 82,068,918 (GRCm39) probably benign Het
Exoc3l4 G A 12: 111,395,921 (GRCm39) D645N probably benign Het
Eya4 T C 10: 22,989,887 (GRCm39) Q513R probably damaging Het
F11 C T 8: 45,698,809 (GRCm39) G445D possibly damaging Het
F13a1 C T 13: 37,172,986 (GRCm39) W131* probably null Het
F13b A C 1: 139,435,940 (GRCm39) S249R probably benign Het
F5 A C 1: 163,981,954 (GRCm39) K73T probably benign Het
F8 C T X: 74,366,755 (GRCm39) probably null Het
Fads2b T G 2: 85,314,525 (GRCm39) K476T probably damaging Het
Fads2b C A 2: 85,332,421 (GRCm39) S201I probably benign Het
Fam117a C G 11: 95,262,350 (GRCm39) H151Q possibly damaging Het
Fam186a T C 15: 99,843,875 (GRCm39) S790G unknown Het
Fam193a A T 5: 34,578,239 (GRCm39) E244D probably benign Het
Fancd2 C G 6: 113,558,383 (GRCm39) H1167D probably benign Het
Far2 A C 6: 148,040,156 (GRCm39) K29T probably damaging Het
Fat1 A G 8: 45,476,844 (GRCm39) I1963M possibly damaging Het
Fat4 C G 3: 39,012,641 (GRCm39) A2312G probably benign Het
Fat4 C G 3: 38,941,199 (GRCm39) L31V possibly damaging Het
Fbln2 G A 6: 91,210,328 (GRCm39) D91N probably damaging Het
Fbn1 C T 2: 125,192,208 (GRCm39) D1434N probably damaging Het
Fbxo16 A T 14: 65,531,309 (GRCm39) K71M possibly damaging Het
Fbxw21 T C 9: 108,974,605 (GRCm39) H305R probably benign Het
Fem1al C G 11: 29,775,007 (GRCm39) G150A probably damaging Het
Fgd4 T A 16: 16,302,334 (GRCm39) K74* probably null Het
Fgfr2 A T 7: 129,771,529 (GRCm39) L596H probably damaging Het
Fhl1 T A X: 55,824,851 (GRCm39) L10Q probably null Het
Fig4 A C 10: 41,129,727 (GRCm39) F498V probably damaging Het
Fign A C 2: 63,927,246 (GRCm39) S6R probably benign Het
Filip1l G C 16: 57,333,768 (GRCm39) S187T probably damaging Het
Fitm2 C T 2: 163,311,785 (GRCm39) E143K probably benign Het
Flnb A C 14: 7,905,871 (GRCm38) K1207T probably benign Het
Flnc G A 6: 29,457,150 (GRCm39) A2351T probably damaging Het
Flt1 T C 5: 147,618,459 (GRCm39) T261A possibly damaging Het
Flt3 C G 5: 147,286,374 (GRCm39) probably null Het
Fmn1 A C 2: 113,272,270 (GRCm39) probably benign Het
Fmo9 A G 1: 166,501,114 (GRCm39) probably null Het
Fn1 A G 1: 71,688,451 (GRCm39) I151T probably damaging Het
Fndc1 T G 17: 8,001,311 (GRCm39) E139A probably damaging Het
Fndc3b G C 3: 27,519,957 (GRCm39) C561W possibly damaging Het
Fndc7 T C 3: 108,790,816 (GRCm39) E70G probably damaging Het
Folh1 T G 7: 86,375,162 (GRCm39) K575T probably benign Het
Foxc2 G C 8: 121,843,698 (GRCm39) W115C possibly damaging Het
Foxc2 G C 8: 121,843,889 (GRCm39) R179P probably damaging Het
Foxl1 G A 8: 121,855,511 (GRCm39) E271K possibly damaging Het
Foxred2 C T 15: 77,836,203 (GRCm39) A385T probably damaging Het
Fpr-rs4 T C 17: 18,242,181 (GRCm39) S63P possibly damaging Het
Fpr-rs4 G A 17: 18,242,956 (GRCm39) R321K probably benign Het
Fras1 T C 5: 96,906,001 (GRCm39) L3135P probably benign Het
Fras1 A C 5: 96,891,070 (GRCm39) Q2866H probably damaging Het
Frem1 C T 4: 82,890,504 (GRCm39) E974K probably damaging Het
Frem3 A C 8: 81,342,055 (GRCm39) Q1449H probably benign Het
Frmd6 A G 12: 70,927,452 (GRCm39) Q144R probably benign Het
Frmd7 T G X: 49,985,024 (GRCm39) N382T possibly damaging Het
Frmpd1 C T 4: 45,284,080 (GRCm39) P967L possibly damaging Het
Frmpd4 G A X: 166,280,836 (GRCm39) T348M probably damaging Het
Fryl A C 5: 73,248,052 (GRCm39) L1022V probably damaging Het
Fryl A C 5: 73,248,081 (GRCm39) L1012R probably damaging Het
Fsd1 T A 17: 56,298,203 (GRCm39) L176H probably damaging Het
Fsip2 A C 2: 82,817,997 (GRCm39) S4577R possibly damaging Het
Fsip2 G C 2: 82,805,792 (GRCm39) E704Q probably damaging Het
Fsip2 A C 2: 82,818,978 (GRCm39) K4904Q possibly damaging Het
Fyb1 G A 15: 6,688,021 (GRCm39) V794I probably benign Het
Fzd10 T C 5: 128,678,310 (GRCm39) L10P probably damaging Het
Fzd7 G C 1: 59,523,029 (GRCm39) G304A probably damaging Het
Gadl1 A T 9: 115,766,338 (GRCm39) I37L probably benign Het
Gal3st1 C G 11: 3,947,984 (GRCm39) P64A probably benign Het
Gal3st2c A G 1: 93,935,867 (GRCm39) H73R probably benign Het
Galnt10 G A 11: 57,612,157 (GRCm39) G66R possibly damaging Het
Garin3 G A 11: 46,298,550 (GRCm39) R618K possibly damaging Het
Gbp2 G A 3: 142,335,776 (GRCm39) D159N probably benign Het
Gbp4 A T 5: 105,268,863 (GRCm39) F430Y probably damaging Het
Gbp9 C A 5: 105,241,991 (GRCm39) G189W probably damaging Het
Gclc G A 9: 77,688,649 (GRCm39) probably null Het
Gcm2 C A 13: 41,256,268 (GRCm39) G494W probably damaging Het
Gcnt2 C A 13: 41,072,115 (GRCm39) P253T probably damaging Het
Gdf10 C T 14: 33,654,347 (GRCm39) R285C probably damaging Het
Gdpd4 A G 7: 97,615,516 (GRCm39) S114G probably damaging Het
Gga1 C A 15: 78,776,221 (GRCm39) D421E probably damaging Het
Ggt5 T G 10: 75,444,593 (GRCm39) F304V possibly damaging Het
Gja3 A C 14: 57,273,272 (GRCm39) L367V possibly damaging Het
Gje1 A C 10: 14,593,868 (GRCm39) F9V possibly damaging Het
Glrb T G 3: 80,752,541 (GRCm39) K407N possibly damaging Het
Glyat A G 19: 12,625,373 (GRCm39) T32A probably benign Het
Gm10784 T G 13: 50,099,179 (GRCm39) noncoding transcript Het
Gm1110 A C 9: 26,824,606 (GRCm39) L145V probably benign Het
Gm11559 C A 11: 99,755,775 (GRCm39) C141* probably null Het
Gm13741 A T 2: 87,486,765 (GRCm39) S167T probably damaging Het
Gm13741 A C 2: 87,487,221 (GRCm39) L15V probably benign Het
Gm15127 A G X: 147,478,492 (GRCm39) T415A probably benign Het
Gm15932 G C 14: 55,813,297 (GRCm39) probably benign Het
Gm1818 C A 12: 48,602,907 (GRCm39) noncoding transcript Het
Gm19965 T G 1: 116,732,330 (GRCm39) F58V probably benign Het
Gm20939 T C 17: 95,184,861 (GRCm39) F503S probably damaging Het
Gm21834 T G 17: 58,049,116 (GRCm39) E33D possibly damaging Het
Gm266 C G 12: 111,451,606 (GRCm39) G200A probably damaging Het
Gm266 T C 12: 111,451,771 (GRCm39) E145G probably damaging Het
Gm4775 C G 14: 106,338,399 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,300 (GRCm39) N90D possibly damaging Het
Gm5114 T C 7: 39,057,871 (GRCm39) K583E probably damaging Het
Gm5565 G A 5: 146,095,479 (GRCm39) T172I probably benign Het
Gm8267 T C 14: 44,962,322 (GRCm39) K33E probably benign Het
Gm8674 T C 13: 50,055,284 (GRCm39) noncoding transcript Het
Gm8674 C A 13: 50,054,830 (GRCm39) noncoding transcript Het
Gm904 A C 13: 50,799,298 (GRCm39) K86Q probably damaging Het
Gm9637 A G 14: 19,401,731 (GRCm38) noncoding transcript Het
Gm9758 C G 5: 14,963,553 (GRCm39) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9964 T C 11: 79,187,234 (GRCm39) E71G unknown Het
Gnal G A 18: 67,324,474 (GRCm39) D210N probably damaging Het
Gnas A G 2: 174,140,166 (GRCm39) S112G probably benign Het
Gnat3 A C 5: 18,220,321 (GRCm39) S228R probably damaging Het
Golgb1 A C 16: 36,740,104 (GRCm39) E2814D probably damaging Het
Gorab C A 1: 163,231,119 (GRCm39) E12* probably null Het
Gorab C G 1: 163,213,892 (GRCm39) S346T possibly damaging Het
Gpaa1 A G 15: 76,216,742 (GRCm39) E142G possibly damaging Het
Gpatch8 T A 11: 102,371,771 (GRCm39) K589I unknown Het
Gphb5 A C 12: 75,462,581 (GRCm39) L3V unknown Het
Gpr141b C T 13: 19,913,379 (GRCm39) noncoding transcript Het
Gpr26 AC A 7: 131,585,823 (GRCm39) probably null Het
Gpr75 T G 11: 30,841,139 (GRCm39) L15V probably benign Het
Gprasp1 G T X: 134,700,190 (GRCm39) A128S possibly damaging Het
Gpsm2 T C 3: 108,608,076 (GRCm39) E234G probably damaging Het
Grid1 G A 14: 35,174,251 (GRCm39) R631H probably damaging Het
Grm3 A C 5: 9,620,183 (GRCm39) F354V probably damaging Het
Grpel1 C T 5: 36,627,958 (GRCm39) R80C probably damaging Het
Gsdmd T G 15: 75,735,323 (GRCm39) D22E probably benign Het
Gtf2f2 C T 14: 76,135,063 (GRCm39) G221S probably damaging Het
Guca1a T C 17: 47,711,335 (GRCm39) I4V probably benign Het
Gucy2c G A 6: 136,720,979 (GRCm39) P406L probably benign Het
Gykl1 T A 18: 52,827,237 (GRCm39) Y148* probably null Het
H2-T22 G A 17: 36,352,530 (GRCm39) R132W probably benign Het
Hao2 A C 3: 98,782,668 (GRCm39) V340G probably damaging Het
Hapln1 A G 13: 89,749,617 (GRCm39) H54R probably benign Het
Haus6 A C 4: 86,521,111 (GRCm39) L176V possibly damaging Het
Hc T G 2: 34,898,261 (GRCm39) T1145P possibly damaging Het
Hc T A 2: 34,919,482 (GRCm39) D668V probably benign Het
Hccs C G X: 168,096,608 (GRCm39) R199T probably damaging Het
Hdac9 T G 12: 34,457,788 (GRCm39) K255T probably damaging Het
Hdlbp G A 1: 93,359,076 (GRCm39) probably benign Het
Heatr5a G A 12: 51,938,187 (GRCm39) A1497V probably damaging Het
Heatr5a T C 12: 51,997,859 (GRCm39) T347A probably benign Het
Hectd4 A T 5: 121,433,566 (GRCm39) probably null Het
Heph T A X: 95,509,637 (GRCm39) V130D probably damaging Het
Hephl1 A T 9: 14,965,017 (GRCm39) L1126H probably damaging Het
Herc2 T G 7: 55,865,129 (GRCm39) V4202G possibly damaging Het
Herc2 G A 7: 55,781,040 (GRCm39) G1235D probably benign Het
Herc2 G A 7: 55,737,089 (GRCm39) A183T probably benign Het
Herc2 G T 7: 55,876,337 (GRCm39) C4450F probably damaging Het
Herc2 C A 7: 55,865,180 (GRCm39) A4219D probably damaging Het
Heyl GGAAGAAG GGAAG 4: 123,133,974 (GRCm39) probably benign Het
Hgf C T 5: 16,823,917 (GRCm39) R705C probably damaging Het
Hip1r A T 5: 124,137,195 (GRCm39) probably null Het
Hipk1 T C 3: 103,671,860 (GRCm39) E413G possibly damaging Het
Hipk3 G A 2: 104,264,974 (GRCm39) S702F probably damaging Het
Hmcn1 G T 1: 150,524,688 (GRCm39) A3414D probably damaging Het
Hmcn2 C A 2: 31,349,076 (GRCm39) probably null Het
Hmcn2 G T 2: 31,271,079 (GRCm39) E1252D probably benign Het
Hmg20b C G 10: 81,182,407 (GRCm39) A310P probably damaging Het
Hnrnpab T G 11: 51,492,573 (GRCm39) probably benign Het
Hoxa6 G C 6: 52,183,525 (GRCm39) F173L possibly damaging Het
Hoxc4 A T 15: 102,943,189 (GRCm39) D14V probably damaging Het
Hpdl G C 4: 116,678,030 (GRCm39) P144A probably damaging Het
Hsd3b6 T G 3: 98,713,648 (GRCm39) K217T probably benign Het
Hsf2 A T 10: 57,372,264 (GRCm39) K72N probably damaging Het
Hsf3 G T X: 95,363,922 (GRCm39) S193* probably null Het
Hsf3 A T X: 95,363,923 (GRCm39) S250T possibly damaging Het
Hspa13 C T 16: 75,555,073 (GRCm39) G338S probably benign Het
Hspa4l C G 3: 40,721,425 (GRCm39) S282* probably null Het
Hydin AGGG AGG 8: 111,319,423 (GRCm39) probably null Het
Hydin A G 8: 111,026,605 (GRCm39) K108E probably benign Het
Hydin G T 8: 111,312,680 (GRCm39) K4140N probably benign Het
I830077J02Rik C A 3: 105,834,529 (GRCm39) A42S probably damaging Het
Iars1 G A 13: 49,874,564 (GRCm39) S746N probably benign Het
Ifi203 A T 1: 173,756,147 (GRCm39) probably benign Het
Ifi206 T G 1: 173,301,577 (GRCm39) E700D probably damaging Het
Ifi209 A C 1: 173,464,973 (GRCm39) K34N probably damaging Het
Ifi209 A G 1: 173,468,712 (GRCm39) K181E probably benign Het
Ifi211 A T 1: 173,735,226 (GRCm39) F68I possibly damaging Het
Ifna16 C A 4: 88,594,615 (GRCm39) S160I probably damaging Het
Ift52 A C 2: 162,865,278 (GRCm39) D43A possibly damaging Het
Ift70b T G 2: 75,768,326 (GRCm39) E142D probably benign Het
Ighv13-2 G T 12: 114,321,435 (GRCm39) Y82* probably null Het
Ighv1-37 A T 12: 114,860,244 (GRCm39) probably benign Het
Ighv15-2 T G 12: 114,528,424 (GRCm39) D43A probably damaging Het
Ighv1-69 A C 12: 115,586,873 (GRCm39) S87A probably benign Het
Ighv5-9-1 C G 12: 113,699,740 (GRCm39) C124S probably damaging Het
Ighv7-4 A C 12: 114,186,517 (GRCm39) V85G probably damaging Het
Igkv12-98 C A 6: 68,548,015 (GRCm39) T48N probably benign Het
Igkv18-36 C A 6: 69,969,483 (GRCm39) V104F probably damaging Het
Igkv2-112 G A 6: 68,197,631 (GRCm39) S101N possibly damaging Het
Igkv5-48 C A 6: 69,703,675 (GRCm39) G77W probably damaging Het
Igsf10 C T 3: 59,237,359 (GRCm39) V941I possibly damaging Het
Ik C T 18: 36,877,835 (GRCm39) R4* probably null Het
Il11 G A 7: 4,778,998 (GRCm39) S44F probably damaging Het
Il18r1 C A 1: 40,517,646 (GRCm39) S136Y probably damaging Het
Il18r1 A C 1: 40,513,911 (GRCm39) K39T probably damaging Het
Il3ra G A 14: 14,351,129 (GRCm38) R217Q probably benign Het
Inpp4b G A 8: 82,795,560 (GRCm39) probably null Het
Inpp5f C G 7: 128,296,673 (GRCm39) T381R probably benign Het
Insm2 C G 12: 55,646,582 (GRCm39) P109A probably damaging Het
Ints11 G A 4: 155,971,427 (GRCm39) D292N probably benign Het
Ipo13 T C 4: 117,761,877 (GRCm39) E441G probably benign Het
Iqub C T 6: 24,500,242 (GRCm39) probably null Het
Itga2 G A 13: 114,993,868 (GRCm39) P762S possibly damaging Het
Itga7 T A 10: 128,785,032 (GRCm39) I787N probably benign Het
Itgb1 T G 8: 129,439,850 (GRCm39) F180V probably damaging Het
Itgb6 C T 2: 60,450,555 (GRCm39) R628Q probably null Het
Itk A C 11: 46,244,689 (GRCm39) probably null Het
Itpr3 C T 17: 27,332,502 (GRCm39) S1782L possibly damaging Het
Itsn2 A C 12: 4,762,472 (GRCm39) S1578R probably damaging Het
Izumo3 C T 4: 92,035,170 (GRCm39) A16T probably damaging Het
Jag1 C A 2: 136,927,071 (GRCm39) W896L probably benign Het
Jakmip1 A T 5: 37,278,330 (GRCm39) I536F probably damaging Het
Jmjd1c T C 10: 67,073,953 (GRCm39) L1896P probably benign Het
Jmy T A 13: 93,577,589 (GRCm39) S860C probably damaging Het
Jph2 G C 2: 163,239,252 (GRCm39) S65R possibly damaging Het
Jrk T C 15: 74,579,243 (GRCm39) K14R unknown Het
Kat6a C T 8: 23,425,517 (GRCm39) R1021* probably null Het
Kbtbd11 C G 8: 15,077,839 (GRCm39) P146R probably damaging Het
Kcna3 C A 3: 106,944,269 (GRCm39) F177L probably damaging Het
Kcna7 T G 7: 45,056,383 (GRCm39) F200V probably benign Het
Kcna7 A T 7: 45,058,529 (GRCm39) K272M probably damaging Het
Kcnb1 G C 2: 167,029,981 (GRCm39) A188G probably benign Het
Kcnb2 A C 1: 15,780,315 (GRCm39) I396L probably benign Het
Kcnb2 C T 1: 15,781,252 (GRCm39) S708L probably benign Het
Kcnh5 C T 12: 74,944,535 (GRCm39) A905T probably benign Het
Kcnh5 A C 12: 75,012,069 (GRCm39) F617V possibly damaging Het
Kcnh6 T G 11: 105,899,874 (GRCm39) F48V probably damaging Het
Kcnh7 G A 2: 63,014,412 (GRCm39) R4C probably damaging Het
Kcnh7 A C 2: 62,566,447 (GRCm39) L828R probably damaging Het
Kcnh8 A G 17: 53,285,320 (GRCm39) S1097G probably benign Het
Kcnh8 G C 17: 53,032,918 (GRCm39) K68N probably damaging Het
Kcnj15 A G 16: 95,096,978 (GRCm39) K200R probably damaging Het
Kcnk9 T A 15: 72,417,864 (GRCm39) T89S possibly damaging Het
Kcnn3 A T 3: 89,574,437 (GRCm39) S650C probably damaging Het
Kcnq5 G A 1: 21,527,753 (GRCm39) P440L probably damaging Het
Kcnt2 G T 1: 140,501,384 (GRCm39) D917Y probably damaging Het
Kcnt2 G A 1: 140,511,896 (GRCm39) W1017* probably null Het
Kctd19 A C 8: 106,111,967 (GRCm39) L826R probably benign Het
Kctd2 A G 11: 115,312,813 (GRCm39) E115G possibly damaging Het
Khdrbs2 T C 1: 32,283,136 (GRCm39) probably benign Het
Khsrp C T 17: 57,331,249 (GRCm39) R443Q probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif18b T G 11: 102,798,983 (GRCm39) K739N probably benign Het
Kif20b G C 19: 34,927,851 (GRCm39) E1038Q probably damaging Het
Kif24 C A 4: 41,395,091 (GRCm39) S594I probably damaging Het
Kif27 T G 13: 58,435,847 (GRCm39) Q1315H probably benign Het
Klhl22 T G 16: 17,594,407 (GRCm39) F179V possibly damaging Het
Klhl26 T G 8: 70,904,449 (GRCm39) E426A probably damaging Het
Klhl41 A C 2: 69,505,074 (GRCm39) K459T possibly damaging Het
Klk1b1 A C 7: 43,619,825 (GRCm39) K128T probably benign Het
Klk1b26 A T 7: 43,665,420 (GRCm39) Q109H probably benign Het
Klk1b3 G A 7: 43,849,729 (GRCm39) W38* probably null Het
Klk1b9 G A 7: 43,443,735 (GRCm39) G83D probably damaging Het
Klk6 T C 7: 43,477,912 (GRCm39) S95P probably benign Het
Klra2 A C 6: 131,205,253 (GRCm39) L196R probably damaging Het
Klrh1 T C 6: 129,749,426 (GRCm39) probably null Het
Kmt2b G T 7: 30,284,676 (GRCm39) Q739K probably benign Het
Kprp G A 3: 92,732,364 (GRCm39) Q229* probably null Het
Kptn T C 7: 15,856,995 (GRCm39) L161P probably damaging Het
Kri1 C A 9: 21,185,418 (GRCm39) E639D probably benign Het
Krt32 C T 11: 99,979,042 (GRCm39) S4N probably benign Het
Krt36 A T 11: 99,995,015 (GRCm39) L186M possibly damaging Het
Krt75 C G 15: 101,482,100 (GRCm39) G56A probably benign Het
Krt76 A G 15: 101,798,986 (GRCm39) L233P probably damaging Het
Krt78 C T 15: 101,855,766 (GRCm39) E682K possibly damaging Het
Krtap20-1 G A 16: 88,881,053 (GRCm39) C28Y unknown Het
Ksr1 G C 11: 78,935,705 (GRCm39) probably null Het
Ksr2 A C 5: 117,885,467 (GRCm39) T764P probably damaging Het
Lama1 G A 17: 68,059,878 (GRCm39) D656N probably benign Het
Lama1 G A 17: 68,078,077 (GRCm39) G1171S probably benign Het
Lama1 G T 17: 68,117,166 (GRCm39) G2487V probably damaging Het
Large1 C T 8: 73,638,731 (GRCm39) W282* probably null Het
Lce1e A G 3: 92,615,156 (GRCm39) C64R unknown Het
Lce1f T C 3: 92,626,561 (GRCm39) K32R unknown Het
Lce1i C A 3: 92,684,596 (GRCm39) probably null Het
Lefty2 A T 1: 180,725,280 (GRCm39) R337W probably damaging Het
Lelp1 T A 3: 92,042,905 (GRCm39) K48M unknown Het
Lenep C G 3: 89,309,876 (GRCm39) G24A probably damaging Het
Lgr6 C T 1: 134,915,809 (GRCm39) G313E possibly damaging Het
Lhb A C 7: 45,071,154 (GRCm39) probably null Het
Lipo2 T C 19: 33,699,085 (GRCm39) Y315C probably damaging Het
Lmbr1 C A 5: 29,528,814 (GRCm39) A110S probably damaging Het
Lmtk2 A G 5: 144,119,669 (GRCm39) S1377G probably benign Het
Lpcat2b C T 5: 107,581,177 (GRCm39) P169S probably damaging Het
Lpin3 T C 2: 160,734,151 (GRCm39) F12S probably damaging Het
Lrfn3 A C 7: 30,059,626 (GRCm39) F200V probably damaging Het
Lrif1 G A 3: 106,639,886 (GRCm39) D324N probably benign Het
Lrp1 G A 10: 127,420,248 (GRCm39) R912C probably damaging Het
Lrp10 A C 14: 54,705,379 (GRCm39) T190P probably benign Het
Lrpprc G A 17: 85,039,212 (GRCm39) Q923* probably null Het
Lrpprc C T 17: 85,077,928 (GRCm39) probably null Het
Lrrc18 C T 14: 32,730,467 (GRCm39) A2V probably damaging Het
Lrrc28 T G 7: 67,179,379 (GRCm39) K329T possibly damaging Het
Lrrc30 T C 17: 67,938,690 (GRCm39) K297E possibly damaging Het
Lrrc32 G A 7: 98,148,267 (GRCm39) R349K probably benign Het
Lrrc45 G T 11: 120,611,057 (GRCm39) V572F probably damaging Het
Lrrc52 C A 1: 167,294,063 (GRCm39) G74V possibly damaging Het
Lrrc63 C T 14: 75,363,430 (GRCm39) E234K possibly damaging Het
Lrrfip1 GAAGAACAAGAA GAAGAA 1: 91,043,252 (GRCm39) probably benign Het
Lrriq1 T A 10: 103,038,307 (GRCm39) N832I probably damaging Het
Lrrk2 T G 15: 91,610,443 (GRCm39) V725G probably benign Het
Ltbp4 C T 7: 27,007,217 (GRCm39) A1364T probably damaging Het
Luc7l T G 17: 26,486,229 (GRCm39) L136R probably damaging Het
Luc7l2 A C 6: 38,580,304 (GRCm39) probably benign Het
Lypd8 A C 11: 58,277,556 (GRCm39) T113P possibly damaging Het
Lyst A T 13: 13,918,018 (GRCm39) Q3359H probably benign Het
Lyzl1 A C 18: 4,181,156 (GRCm39) K114T probably damaging Het
Magel2 G T 7: 62,028,725 (GRCm39) R543L possibly damaging Het
Mak16 A G 8: 31,656,123 (GRCm39) L120P probably damaging Het
Man2b2 C T 5: 36,972,700 (GRCm39) D605N possibly damaging Het
Map10 CGGG CGG 8: 126,398,670 (GRCm39) probably null Het
Map1b T G 13: 99,644,623 (GRCm39) E93D probably benign Het
Map1s T G 8: 71,369,093 (GRCm39) F881V possibly damaging Het
Map3k3 G A 11: 106,041,179 (GRCm39) D383N possibly damaging Het
Map3k6 C G 4: 132,972,377 (GRCm39) H318D probably damaging Het
Mapk13 A G 17: 28,996,507 (GRCm39) E245G possibly damaging Het
Mapkapk5 C T 5: 121,669,654 (GRCm39) E115K probably benign Het
Marchf10 C A 11: 105,281,185 (GRCm39) G367W probably damaging Het
Marveld3 G A 8: 110,674,695 (GRCm39) R374C possibly damaging Het
Mast4 T G 13: 102,875,027 (GRCm39) K1255T probably damaging Het
Maz GGCCCTG GG 7: 126,623,646 (GRCm39) probably null Het
Mcf2 T C X: 59,224,073 (GRCm39) H65R probably benign Het
Mcm6 T G 1: 128,272,035 (GRCm39) N454T probably damaging Het
Mcpt4 T A 14: 56,297,967 (GRCm39) R195* probably null Het
Mdm1 A C 10: 117,994,267 (GRCm39) K380N possibly damaging Het
Mdm4 A G 1: 132,922,285 (GRCm39) S286P probably benign Het
Med13l C A 5: 118,887,706 (GRCm39) T1660K probably damaging Het
Med14 A C X: 12,543,845 (GRCm39) L1451R probably damaging Het
Megf11 A T 9: 64,567,758 (GRCm39) S416C probably damaging Het
Megf8 G A 7: 25,039,094 (GRCm39) E902K possibly damaging Het
Mep1a C G 17: 43,802,487 (GRCm39) W192C probably damaging Het
Mfap3 T A 11: 57,418,968 (GRCm39) F43I possibly damaging Het
Mfhas1 C G 8: 36,057,390 (GRCm39) P622A probably benign Het
Mgam G C 6: 40,619,994 (GRCm39) V28L probably benign Het
Mgp T G 6: 136,851,261 (GRCm39) probably null Het
Micall2 A C 5: 139,702,050 (GRCm39) L398V probably benign Het
Micall2 T A 5: 139,692,649 (GRCm39) K908M probably damaging Het
Mill2 G A 7: 18,590,324 (GRCm39) probably null Het
Mir1966 C T 8: 106,342,203 (GRCm39) R130* probably null Het
Mkrn1 T A 6: 39,377,390 (GRCm39) N282Y probably null Het
Mkx C T 18: 6,936,975 (GRCm39) A319T probably damaging Het
Mn1 T A 5: 111,566,146 (GRCm39) F39I possibly damaging Het
Morc2b A T 17: 33,355,060 (GRCm39) I904N possibly damaging Het
Mpo T G 11: 87,686,071 (GRCm39) F74V probably benign Het
Mpv17l2 T G 8: 71,212,056 (GRCm39) K139T probably damaging Het
Mrgprb4 A G 7: 47,848,430 (GRCm39) L166P possibly damaging Het
Mrgprg C G 7: 143,318,393 (GRCm39) A240P probably damaging Het
Mrgprx1 T G 7: 47,670,877 (GRCm39) K290T probably damaging Het
Mroh5 G A 15: 73,659,880 (GRCm39) A320V possibly damaging Het
Mrpl1 T G 5: 96,409,928 (GRCm39) M267R probably damaging Het
Mrpl2 A G 17: 46,958,404 (GRCm39) K62R probably null Het
Mrps36 T G 13: 100,875,641 (GRCm39) S58R possibly damaging Het
Msantd3 A C 4: 48,552,525 (GRCm39) D38A probably damaging Het
Mta1 C T 12: 113,096,820 (GRCm39) P547L probably benign Het
Mta3 A G 17: 84,070,343 (GRCm39) D16G probably benign Het
Mtcl1 C T 17: 66,650,723 (GRCm39) A1132T probably benign Het
Mtf2 A G 5: 108,235,195 (GRCm39) D139G probably damaging Het
Mthfd1l T G 10: 3,957,844 (GRCm39) F294V probably benign Het
Mtus2 G A 5: 148,240,073 (GRCm39) probably benign Het
Muc4 A T 16: 32,576,450 (GRCm39) probably benign Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Muc5ac A C 7: 141,365,429 (GRCm39) T1984P possibly damaging Het
Muc5b A G 7: 141,415,951 (GRCm39) S2966G probably benign Het
Mup3 G C 4: 62,005,426 (GRCm39) L15V unknown Het
Mvd G C 8: 123,166,469 (GRCm39) A56G probably benign Het
Mvk G T 5: 114,596,995 (GRCm39) G321W probably damaging Het
Mxra7 G T 11: 116,695,432 (GRCm39) N157K probably benign Het
Mybpc2 T C 7: 44,165,927 (GRCm39) K256R possibly damaging Het
Mybpc3 A G 2: 90,965,704 (GRCm39) E1172G probably benign Het
Myh11 AGG AG 16: 14,087,126 (GRCm39) probably null Het
Myh2 C T 11: 67,082,275 (GRCm39) L1326F probably damaging Het
Myh2 GTATTTATTTA GTATTTA 11: 67,071,589 (GRCm39) probably benign Het
Myh6 C T 14: 55,194,454 (GRCm39) R725H probably damaging Het
Myh8 A C 11: 67,189,418 (GRCm39) K1198T probably damaging Het
Myh9 A G 15: 77,659,458 (GRCm39) L96P probably damaging Het
Myo18b C T 5: 112,905,350 (GRCm39) E2083K probably benign Het
Myo18b G A 5: 112,840,809 (GRCm39) S2328L possibly damaging Het
Myo1d T G 11: 80,565,724 (GRCm39) N367T probably benign Het
Myo5b G C 18: 74,877,820 (GRCm39) E1606D probably benign Het
Myo5c C G 9: 75,152,341 (GRCm39) S76R probably damaging Het
Myorg A C 4: 41,497,557 (GRCm39) L691R probably benign Het
Myrf C A 19: 10,198,662 (GRCm39) Q195H probably damaging Het
Nacc1 G C 8: 85,399,915 (GRCm39) A434G probably damaging Het
Naip2 A T 13: 100,298,417 (GRCm39) Y540N probably benign Het
Nap1l2 T G X: 102,228,802 (GRCm39) N372T probably damaging Het
Nat8 G T 6: 85,808,175 (GRCm39) probably benign Het
Nav1 T C 1: 135,398,462 (GRCm39) T707A probably benign Het
Nbea G A 3: 55,630,584 (GRCm39) T2251I probably benign Het
Nbeal2 G C 9: 110,461,440 (GRCm39) A1536G possibly damaging Het
Ncapg T G 5: 45,837,222 (GRCm39) L431R probably damaging Het
Nck2 A C 1: 43,593,543 (GRCm39) N250T possibly damaging Het
Nckap5 G A 1: 125,952,569 (GRCm39) R1264C possibly damaging Het
Nckipsd G C 9: 108,691,876 (GRCm39) K492N probably benign Het
Ncor2 T A 5: 125,144,852 (GRCm39) S597C unknown Het
Ncor2 C T 5: 125,163,904 (GRCm39) probably null Het
Ndn T G 7: 61,998,882 (GRCm39) F243V probably damaging Het
Ndufs6 A G 13: 73,476,555 (GRCm39) V4A probably benign Het
Neb C T 2: 52,059,884 (GRCm39) V2321I possibly damaging Het
Neb T A 2: 52,198,579 (GRCm39) K423M probably damaging Het
Neb G C 2: 52,113,164 (GRCm39) P7A probably benign Het
Nedd4 G A 9: 72,577,360 (GRCm39) V62M probably benign Het
Nek7 C A 1: 138,443,363 (GRCm39) V197L probably null Het
Nelfcd GTT GT 2: 174,268,287 (GRCm39) probably null Het
Nell2 A T 15: 95,332,978 (GRCm39) L194M probably damaging Het
Neurod6 G A 6: 55,656,347 (GRCm39) Q97* probably null Het
Nfkbiz T C 16: 55,638,599 (GRCm39) Y287C probably damaging Het
Nfkbiz G C 16: 55,636,801 (GRCm39) A500G probably damaging Het
Nfrkb A C 9: 31,322,629 (GRCm39) S900R possibly damaging Het
Nhsl3 C T 4: 129,116,091 (GRCm39) A903T probably damaging Het
Nipbl T A 15: 8,337,366 (GRCm39) E2065D probably damaging Het
Nkapl C G 13: 21,652,473 (GRCm39) G47R unknown Het
Nlrc5 A G 8: 95,231,092 (GRCm39) D1275G possibly damaging Het
Nlrp12 T C 7: 3,271,211 (GRCm39) K1034R probably benign Het
Nlrp14 T G 7: 106,785,829 (GRCm39) L635R probably damaging Het
Nlrp3 G C 11: 59,442,686 (GRCm39) S746T possibly damaging Het
Nlrp4a T C 7: 26,153,588 (GRCm39) V713A probably benign Het
Nlrp4c A C 7: 6,069,635 (GRCm39) K512T probably damaging Het
Nlrp4f C T 13: 65,342,116 (GRCm39) E510K probably benign Het
Nlrp4g T G 9: 124,349,201 (GRCm38) noncoding transcript Het
Nlrp5 T C 7: 23,117,011 (GRCm39) L245P probably damaging Het
Nlrp5 G A 7: 23,103,592 (GRCm39) E20K possibly damaging Het
Nlrp9b T G 7: 19,757,668 (GRCm39) F302V probably benign Het
Nme8 T A 13: 19,873,127 (GRCm39) E172D possibly damaging Het
Nnt G A 13: 119,474,982 (GRCm39) S649L probably damaging Het
Nod2 G C 8: 89,390,774 (GRCm39) Q345H probably damaging Het
Nol4 C T 18: 23,054,959 (GRCm39) S157N probably damaging Het
Nolc1 G T 19: 46,071,537 (GRCm39) probably benign Het
Notch1 T G 2: 26,367,127 (GRCm39) D680A probably damaging Het
Notch3 C G 17: 32,377,626 (GRCm39) G150A possibly damaging Het
Notch4 C T 17: 34,806,889 (GRCm39) P1942L probably damaging Het
Nr3c2 C A 8: 77,635,261 (GRCm39) Q121K possibly damaging Het
Nr4a2 C T 2: 57,001,626 (GRCm39) G213S probably damaging Het
Nrg1 G C 8: 32,408,033 (GRCm39) L67V possibly damaging Het
Nrxn1 T A 17: 90,366,933 (GRCm39) D31V probably damaging Het
Nsd1 A C 13: 55,361,661 (GRCm39) S210R possibly damaging Het
Nsd2 T C 5: 34,013,082 (GRCm39) probably null Het
Nsd3 CCTTCT CCT 8: 26,131,018 (GRCm39) probably benign Het
Nsun2 A T 13: 69,763,584 (GRCm39) K103M probably damaging Het
Ntn5 G C 7: 45,343,627 (GRCm39) G322A probably damaging Het
Nudt4 C T 10: 95,388,377 (GRCm39) G60S probably benign Het
Numa1 C A 7: 101,647,609 (GRCm39) Q447K probably benign Het
Numa1 T G 7: 101,647,538 (GRCm39) L423R probably damaging Het
Nup214 T C 2: 31,901,235 (GRCm39) F940L probably benign Het
Nxpe5 G A 5: 138,239,176 (GRCm39) probably null Het
Nxph2 G T 2: 23,290,229 (GRCm39) A194S probably benign Het
Oaz1 C G 10: 80,662,663 (GRCm39) R24G possibly damaging Het
Obox2 A G 7: 15,131,263 (GRCm39) K123R possibly damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Oca2 G T 7: 55,980,123 (GRCm39) K609N probably null Het
Ocln G A 13: 100,671,560 (GRCm39) R266* probably null Het
Ocstamp C A 2: 165,237,838 (GRCm39) Q475H possibly damaging Het
Odad2 G A 18: 7,266,919 (GRCm39) S394L probably benign Het
Odf1 A G 15: 38,219,918 (GRCm39) Y82C probably benign Het
Ogdh A C 11: 6,305,427 (GRCm39) D978A probably benign Het
Olfm3 G T 3: 114,698,317 (GRCm39) probably benign Het
Olfm5 T G 7: 103,803,357 (GRCm39) S294R probably damaging Het
Omg G C 11: 79,393,146 (GRCm39) N237K possibly damaging Het
Oog3 T A 4: 143,884,877 (GRCm39) N353I probably benign Het
Oog3 A G 4: 143,886,206 (GRCm39) F131L probably benign Het
Or10a2 C A 7: 106,673,612 (GRCm39) D192E possibly damaging Het
Or10a3m T G 7: 108,312,745 (GRCm39) F50V probably benign Het
Or10a3n G T 7: 108,492,980 (GRCm39) F211L probably damaging Het
Or10a48 A C 7: 108,425,103 (GRCm39) Y34* probably null Het
Or10ag52 T G 2: 87,044,122 (GRCm39) I295M possibly damaging Het
Or10ag54 G T 2: 87,099,919 (GRCm39) G265* probably null Het
Or10ag58 A G 2: 87,265,503 (GRCm39) Y224C probably damaging Het
Or10ag59 T C 2: 87,406,024 (GRCm39) S199P possibly damaging Het
Or10ak8 A C 4: 118,773,785 (GRCm39) L293R probably damaging Het
Or10al4 T A 17: 38,036,983 (GRCm39) F23I probably damaging Het
Or10g9b A G 9: 39,917,892 (GRCm39) S118P probably damaging Het
Or10j5 T A 1: 172,784,891 (GRCm39) F176L probably damaging Het
Or10q12 C A 19: 13,745,780 (GRCm39) P25T probably benign Het
Or10x1 G A 1: 174,197,310 (GRCm39) V276I probably benign Het
Or11g26 T C 14: 50,752,984 (GRCm39) F108L possibly damaging Het
Or12d13 A C 17: 37,647,596 (GRCm39) F176V probably damaging Het
Or12e10 C A 2: 87,641,090 (GRCm39) L309I probably damaging Het
Or12j5 A C 7: 140,083,718 (GRCm39) V218G probably benign Het
Or13a27 A G 7: 139,925,717 (GRCm39) F62L probably benign Het
Or13a28 A G 7: 140,218,133 (GRCm39) K173R probably benign Het
Or13p3 A G 4: 118,567,423 (GRCm39) K273R probably benign Het
Or14c43 T A 7: 86,114,954 (GRCm39) F112I possibly damaging Het
Or14j10 G T 17: 37,935,320 (GRCm39) L69M probably damaging Het
Or1e17 G A 11: 73,831,964 (GRCm39) M297I probably benign Het
Or1e19 T C 11: 73,315,931 (GRCm39) S293G probably benign Het
Or1j12 T G 2: 36,342,918 (GRCm39) F107C possibly damaging Het
Or1l4b T G 2: 37,036,397 (GRCm39) F58V probably benign Het
Or1p1 T C 11: 74,179,661 (GRCm39) L63P probably damaging Het
Or1q1 A C 2: 36,887,717 (GRCm39) K298N possibly damaging Het
Or2ag12 T G 7: 106,277,664 (GRCm39) S10R probably benign Het
Or2ag15 A T 7: 106,340,350 (GRCm39) S264T probably benign Het
Or2ag2 T A 7: 106,485,503 (GRCm39) I174F probably damaging Het
Or2d36 A C 7: 106,747,419 (GRCm39) S299R probably benign Het
Or2l13 T C 16: 19,305,798 (GRCm39) L70P possibly damaging Het
Or2y15 T G 11: 49,351,283 (GRCm39) L259R probably damaging Het
Or2z9 T G 8: 72,854,361 (GRCm39) F252L probably benign Het
Or3a1 A T 11: 74,225,518 (GRCm39) F180I probably damaging Het
Or4c110 C A 2: 88,832,182 (GRCm39) G150V possibly damaging Het
Or4c12 A G 2: 89,774,114 (GRCm39) V115A probably benign Het
Or4d10b T C 19: 12,036,493 (GRCm39) T208A probably benign Het
Or4e2 C A 14: 52,688,666 (GRCm39) F265L probably benign Het
Or4f53 T G 2: 111,088,204 (GRCm39) V248G possibly damaging Het
Or4k41 T C 2: 111,279,802 (GRCm39) F106L probably benign Het
Or4k44 A C 2: 111,368,159 (GRCm39) I158M possibly damaging Het
Or4p23 A C 2: 88,576,922 (GRCm39) F103L probably damaging Het
Or4s2b T G 2: 88,509,008 (GRCm39) F263V probably damaging Het
Or51a42 A C 7: 103,708,523 (GRCm39) S95R possibly damaging Het
Or51ah3 G C 7: 103,210,597 (GRCm39) L304F probably damaging Het
Or51ah3 A G 7: 103,210,266 (GRCm39) K194R probably benign Het
Or52e15 C A 7: 104,645,661 (GRCm39) G150V probably benign Het
Or52n2b G T 7: 104,565,873 (GRCm39) A210E probably benign Het
Or52s1b A G 7: 102,822,013 (GRCm39) L277P possibly damaging Het
Or52z1 T G 7: 103,436,572 (GRCm39) K304T probably damaging Het
Or52z15 T G 7: 103,332,393 (GRCm39) I156S probably benign Het
Or56b2j T C 7: 104,353,700 (GRCm39) Y309H probably benign Het
Or5an6 A C 19: 12,371,663 (GRCm39) K12T probably benign Het
Or5an9 A C 19: 12,187,854 (GRCm39) K308T possibly damaging Het
Or5b101 A C 19: 13,005,391 (GRCm39) F101V probably benign Het
Or5b116 T C 19: 13,423,213 (GRCm39) V279A possibly damaging Het
Or5b121 T G 19: 13,507,216 (GRCm39) F104V possibly damaging Het
Or5b124 C A 19: 13,610,817 (GRCm39) A114E probably damaging Het
Or5b21 T C 19: 12,839,648 (GRCm39) C170R probably damaging Het
Or5bb10 C A 19: 12,206,588 (GRCm39) W107C probably damaging Het
Or5d16 G A 2: 87,773,792 (GRCm39) P60L probably damaging Het
Or5e1 T G 7: 108,354,311 (GRCm39) L83V probably benign Het
Or5g26 C T 2: 85,493,960 (GRCm39) V273I probably benign Het
Or5i1 G T 2: 87,612,972 (GRCm39) L29F probably damaging Het
Or5j1 A C 2: 86,878,777 (GRCm39) L268V probably benign Het
Or5m13b T G 2: 85,754,142 (GRCm39) F177V probably damaging Het
Or5m3b T C 2: 85,872,063 (GRCm39) S135P probably damaging Het
Or5m9b G T 2: 85,905,667 (GRCm39) E194D possibly damaging Het
Or5p56 G A 7: 107,589,938 (GRCm39) R122H probably benign Het
Or5p57 C A 7: 107,665,534 (GRCm39) C127F probably damaging Het
Or5p73 T A 7: 108,064,578 (GRCm39) F16I probably benign Het
Or5p76 A C 7: 108,122,605 (GRCm39) F184C probably damaging Het
Or5t5 A G 2: 86,616,817 (GRCm39) K248E probably damaging Het
Or5w16 G T 2: 87,576,833 (GRCm39) A98S probably damaging Het
Or5w20 G A 2: 87,726,977 (GRCm39) A145T probably benign Het
Or6c201 T G 10: 128,968,944 (GRCm39) K231T probably benign Het
Or6c214 A C 10: 129,591,208 (GRCm39) I37S possibly damaging Het
Or6c217 T C 10: 129,738,552 (GRCm39) E9G possibly damaging Het
Or6c74 A C 10: 129,869,657 (GRCm39) K54T probably damaging Het
Or6k6 C T 1: 173,944,881 (GRCm39) A234T probably benign Het
Or6n2 C T 1: 173,897,515 (GRCm39) S217F probably damaging Het
Or7d10 T A 9: 19,832,008 (GRCm39) F168I probably damaging Het
Or7e173 A G 9: 19,938,575 (GRCm39) S220P probably damaging Het
Or7g19 G A 9: 18,856,717 (GRCm39) V258I possibly damaging Het
Or7g29 G A 9: 19,286,980 (GRCm39) L66F probably damaging Het
Or8b101 T C 9: 38,020,882 (GRCm39) V295A probably damaging Het
Or8b46 T C 9: 38,450,445 (GRCm39) F85L probably damaging Het
Or8b47 T G 9: 38,435,155 (GRCm39) N42K probably damaging Het
Or8b9 A C 9: 37,766,614 (GRCm39) S167R probably benign Het
Or8c17 T C 9: 38,179,908 (GRCm39) L33S probably damaging Het
Or8g17 A C 9: 38,930,085 (GRCm39) F251V probably damaging Het
Or8g28 G A 9: 39,169,167 (GRCm39) S270L probably benign Het
Or8h9 T G 2: 86,789,010 (GRCm39) K264T probably benign Het
Or8k23 A T 2: 86,186,237 (GRCm39) I163N probably benign Het
Or8k24 T G 2: 86,216,523 (GRCm39) K80Q probably damaging Het
Or8k24 T C 2: 86,216,100 (GRCm39) I221V probably benign Het
Or8k3 C A 2: 86,058,566 (GRCm39) V250F probably damaging Het
Or8k33 C T 2: 86,384,310 (GRCm39) A53T probably benign Het
Or8u10 C T 2: 85,915,326 (GRCm39) S265N probably benign Het
Or9g8 T G 2: 85,607,466 (GRCm39) D179E probably damaging Het
Or9i14 A C 19: 13,792,912 (GRCm39) L14R probably damaging Het
Or9m1 A C 2: 87,733,928 (GRCm39) F31V possibly damaging Het
Or9s27 T A 1: 92,516,273 (GRCm39) S74T probably damaging Het
Orc2 A C 1: 58,515,675 (GRCm39) F230V probably benign Het
Osbpl3 A G 6: 50,274,077 (GRCm39) F846L probably damaging Het
Pabpc1l G C 2: 163,874,244 (GRCm39) probably null Het
Pah C T 10: 87,407,153 (GRCm39) S303F probably damaging Het
Paip2b T G 6: 83,785,864 (GRCm39) N122T probably benign Het
Pak4 G T 7: 28,264,653 (GRCm39) T83N probably damaging Het
Pamr1 C A 2: 102,464,791 (GRCm39) F313L possibly damaging Het
Papln C G 12: 83,823,150 (GRCm39) P396A probably benign Het
Papss1 C G 3: 131,348,728 (GRCm39) H559Q possibly damaging Het
Parp14 C G 16: 35,661,956 (GRCm39) D1360H probably damaging Het
Pask C T 1: 93,244,523 (GRCm39) S1166N probably damaging Het
Pbk T A 14: 66,051,397 (GRCm39) V145D probably damaging Het
Pbrm1 G A 14: 30,832,411 (GRCm39) R1443Q possibly damaging Het
Pcbp3 C A 10: 76,599,157 (GRCm39) Q326H probably benign Het
Pcdh1 G C 18: 38,331,120 (GRCm39) R767G probably damaging Het
Pcdh17 A G 14: 84,685,714 (GRCm39) K727R possibly damaging Het
Pcdha2 G T 18: 37,074,174 (GRCm39) G602C probably damaging Het
Pcdha6 G A 18: 37,102,270 (GRCm39) A488T probably damaging Het
Pcdhac1 G T 18: 37,225,243 (GRCm39) L685F probably damaging Het
Pcdhac1 G T 18: 37,225,619 (GRCm39) A811S probably damaging Het
Pcdhb21 A G 18: 37,647,594 (GRCm39) E241G probably benign Het
Pcdhb22 A C 18: 37,652,398 (GRCm39) T289P probably benign Het
Pcdhb6 T A 18: 37,468,199 (GRCm39) D373E probably damaging Het
Pcdhga11 G C 18: 37,889,237 (GRCm39) G82R probably damaging Het
Pcmtd1 C T 1: 7,233,554 (GRCm39) P222L possibly damaging Het
Pcnx2 T G 8: 126,592,757 (GRCm39) S736R probably damaging Het
Pcnx2 C T 8: 126,553,667 (GRCm39) E1151K probably damaging Het
Pcsk5 A G 19: 17,440,738 (GRCm39) L1284P probably damaging Het
Pdgfra C T 5: 75,327,238 (GRCm39) S145F probably benign Het
Pdrg1 C T 2: 152,855,957 (GRCm39) A46T probably damaging Het
Pds5a A C 5: 65,776,329 (GRCm39) I88M probably damaging Het
Pdzk1 A G 3: 96,761,873 (GRCm39) N162D probably benign Het
Peds1 G C 2: 167,486,784 (GRCm39) Y198* probably null Het
Pelp1 A G 11: 70,287,716 (GRCm39) L402P probably damaging Het
Pex1 G A 5: 3,656,075 (GRCm39) A301T probably benign Het
Pex6 A T 17: 47,023,148 (GRCm39) Q241H possibly damaging Het
Pgap4 A G 4: 49,587,135 (GRCm39) L11P probably damaging Het
Pgm3 A G 9: 86,446,760 (GRCm39) F253L probably damaging Het
Phaf1 C T 8: 105,957,804 (GRCm39) R37C probably damaging Het
Pi4k2b G A 5: 52,918,273 (GRCm39) R367Q possibly damaging Het
Pi4kb T G 3: 94,891,820 (GRCm39) F179V probably damaging Het
Pid1 T G 1: 84,093,735 (GRCm39) N51T probably benign Het
Piezo2 C T 18: 63,203,065 (GRCm39) G1525D probably damaging Het
Piga A C X: 163,205,905 (GRCm39) K88N probably damaging Het
Pigo G C 4: 43,019,409 (GRCm39) P970A probably damaging Het
Pik3r6 G A 11: 68,416,428 (GRCm39) V6M probably damaging Het
Piwil4 G A 9: 14,645,813 (GRCm39) H142Y probably damaging Het
Pkd1 T G 17: 24,784,579 (GRCm39) L375R probably benign Het
Pkd2 T G 5: 104,646,727 (GRCm39) L780V probably damaging Het
Pkdcc A G 17: 83,529,579 (GRCm39) E380G probably damaging Het
Pla2g12a C T 3: 129,684,029 (GRCm39) S136F probably benign Het
Pla2g2c T C 4: 138,461,597 (GRCm39) F22S probably damaging Het
Pla2g4c A T 7: 13,063,678 (GRCm39) Q48H probably benign Het
Plb1 T G 5: 32,468,191 (GRCm39) F503V probably damaging Het
Plb1 C T 5: 32,468,261 (GRCm39) S526L probably benign Het
Plcb1 A C 2: 135,062,766 (GRCm39) E27D probably benign Het
Plcl2 C A 17: 50,914,020 (GRCm39) P343H probably damaging Het
Pld1 A C 3: 28,083,392 (GRCm39) I171L probably benign Het
Plod2 T G 9: 92,485,088 (GRCm39) F551V probably benign Het
Plxna2 A C 1: 194,326,749 (GRCm39) I228L possibly damaging Het
Plxna2 A G 1: 194,446,847 (GRCm39) N786D probably benign Het
Plxnd1 C A 6: 115,944,471 (GRCm39) S1033I probably benign Het
Pmfbp1 A C 8: 110,240,576 (GRCm39) E219D probably damaging Het
Pml G T 9: 58,141,873 (GRCm39) L320M probably damaging Het
Pnisr C G 4: 21,873,684 (GRCm39) R476G probably benign Het
Pnliprp2 G A 19: 58,750,757 (GRCm39) A149T probably damaging Het
Pnp T G 14: 51,188,952 (GRCm39) D248E probably benign Het
Pnpla5 A G 15: 84,007,272 (GRCm39) S15P probably damaging Het
Pogz T A 3: 94,786,387 (GRCm39) F992I probably damaging Het
Pole C T 5: 110,475,731 (GRCm39) L1847F possibly damaging Het
Polr2b T G 5: 77,490,569 (GRCm39) I903S possibly damaging Het
Polr2b G A 5: 77,493,248 (GRCm39) G1077S probably damaging Het
Polr3a A C 14: 24,529,792 (GRCm39) V266G probably damaging Het
Pop1 C G 15: 34,499,465 (GRCm39) A10G probably damaging Het
Pop7 T C 5: 137,500,273 (GRCm39) Y20C probably damaging Het
Postn A T 3: 54,282,548 (GRCm39) D503V probably benign Het
Pou4f2 C G 8: 79,162,230 (GRCm39) Q124H probably benign Het
Ppl G A 16: 4,907,371 (GRCm39) R975W probably damaging Het
Ppp1cc C T 5: 122,310,816 (GRCm39) S182F possibly damaging Het
Ppp1r10 ACATGATGTCCCTAGCCAT ACAT 17: 36,241,659 (GRCm39) probably benign Het
Ppp1r7 T C 1: 93,280,310 (GRCm39) L126P probably damaging Het
Ppp2r1b A C 9: 50,778,211 (GRCm39) E309D probably damaging Het
Ppp4r3c1 C A X: 88,973,843 (GRCm39) D785Y unknown Het
Ppp4r3c1 T G X: 88,973,842 (GRCm39) D785A unknown Het
Pramel18 A C 4: 101,767,383 (GRCm39) I211L probably benign Het
Pramel18 A G 4: 101,766,315 (GRCm39) probably null Het
Pramel21 C A 4: 143,341,802 (GRCm39) A77E possibly damaging Het
Pramel23 T G 4: 143,424,650 (GRCm39) Q264H probably benign Het
Pramel24 T C 4: 143,453,603 (GRCm39) L237P probably damaging Het
Pramel28 C T 4: 143,692,132 (GRCm39) E290K probably benign Het
Pramel58 C A 5: 94,831,692 (GRCm39) A233E probably benign Het
Prdm1 G A 10: 44,317,921 (GRCm39) R301W probably damaging Het
Prg2 G T 2: 84,812,609 (GRCm39) K106N possibly damaging Het
Prkg2 A T 5: 99,172,663 (GRCm39) H17Q probably benign Het
Prob1 G C 18: 35,785,822 (GRCm39) P811A possibly damaging Het
Prox1 G C 1: 189,894,196 (GRCm39) A83G probably damaging Het
Prr23a1 G A 9: 98,725,400 (GRCm39) R254Q possibly damaging Het
Prr27 G A 5: 87,990,505 (GRCm39) R31H probably damaging Het
Prr30 G C 14: 101,435,576 (GRCm39) Q329E probably benign Het
Prrc2b G A 2: 32,106,744 (GRCm39) R1582K probably damaging Het
Prrc2b C A 2: 32,104,441 (GRCm39) N1306K probably benign Het
Prrx1 A C 1: 163,089,446 (GRCm39) L127R probably damaging Het
Prss36 G A 7: 127,533,709 (GRCm39) R32* probably null Het
Prss53 C T 7: 127,486,570 (GRCm39) W352* probably null Het
Psd3 T C 8: 68,358,912 (GRCm39) silent Het
Psg17 G A 7: 18,550,835 (GRCm39) T340I probably benign Het
Psmd11 A ATC 11: 80,362,376 (GRCm39) probably null Het
Ptcra G C 17: 47,074,521 (GRCm39) A7G probably damaging Het
Pten A C 19: 32,777,398 (GRCm39) T131P probably damaging Het
Pten C T 19: 32,753,451 (GRCm39) A39V probably damaging Het
Ptgfrn T G 3: 100,963,753 (GRCm39) T620P probably damaging Het
Ptgr3 G A 18: 84,113,052 (GRCm39) V243I probably damaging Het
Ptprn T A 1: 75,237,264 (GRCm39) M20L possibly damaging Het
Ptprq C T 10: 107,535,533 (GRCm39) A411T possibly damaging Het
Ptprt A G 2: 162,080,041 (GRCm39) S253P possibly damaging Het
Rab3gap2 A T 1: 185,013,874 (GRCm39) L1173F probably damaging Het
Rac1 C A 5: 143,500,474 (GRCm39) A59S probably damaging Het
Rad21 T G 15: 51,846,022 (GRCm39) K16T probably damaging Het
Rad21l C T 2: 151,509,939 (GRCm39) R54Q probably damaging Het
Rad9b A G 5: 122,471,435 (GRCm39) F210L possibly damaging Het
Raet1e A C 10: 22,057,850 (GRCm39) T206P possibly damaging Het
Ralgapa2 T G 2: 146,276,825 (GRCm39) S472R probably benign Het
Ranbp2 AGTTTGTGCTCGGT AGTTTGTGCTCGGTTTGTGCTCGGT 10: 58,313,794 (GRCm39) probably null Het
Ranbp2 A T 10: 58,328,715 (GRCm39) Q2871H probably benign Het
Ranbp2 GGT GGTTTGTGCTCCGT 10: 58,313,805 (GRCm39) probably null Het
Rapgefl1 C G 11: 98,736,721 (GRCm39) P285R probably damaging Het
Rasgrp4 A C 7: 28,849,961 (GRCm39) probably benign Het
Rassf7 C G 7: 140,797,058 (GRCm39) S90R probably damaging Het
Rassf8 A C 6: 145,762,342 (GRCm39) E371A probably benign Het
Rassf8 A G 6: 145,761,208 (GRCm39) Q178R probably benign Het
Rb1cc1 AT ATT 1: 6,319,242 (GRCm39) probably null Het
Rbm12b1 G T 4: 12,146,079 (GRCm39) V684L probably benign Het
Rdh16f1 A C 10: 127,624,702 (GRCm39) K180T probably damaging Het
Rec8 A T 14: 55,862,604 (GRCm39) K553M probably damaging Het
Reg1 G T 6: 78,403,901 (GRCm39) E23* probably null Het
Rergl C A 6: 139,470,424 (GRCm39) E135* probably null Het
Resp18 T C 1: 75,254,935 (GRCm39) K6R possibly damaging Het
Rev3l C A 10: 39,700,314 (GRCm39) Q1604K probably benign Het
Rfc3 C T 5: 151,568,327 (GRCm39) R213H probably benign Het
Rfwd3 C A 8: 112,024,238 (GRCm39) G28V probably benign Het
Rfx3 G A 19: 27,814,850 (GRCm39) S169F probably damaging Het
Rfx8 T G 1: 39,722,126 (GRCm39) E286D possibly damaging Het
Rgl1 G A 1: 152,550,771 (GRCm39) probably benign Het
Rgs11 G C 17: 26,424,746 (GRCm39) Q218H probably benign Het
Rgs7 T C 1: 174,911,586 (GRCm39) E345G possibly damaging Het
Rims1 C G 1: 22,358,810 (GRCm39) A1258P probably damaging Het
Rint1 A G 5: 24,010,312 (GRCm39) N174D probably benign Het
Ripk3 T G 14: 56,025,383 (GRCm39) E60D possibly damaging Het
Rnf146 G A 10: 29,223,568 (GRCm39) A106V probably damaging Het
Rnf213 A G 11: 119,368,080 (GRCm39) K4705R possibly damaging Het
Rnmt C T 18: 68,440,745 (GRCm39) S136L probably benign Het
Rp1l1 C T 14: 64,266,207 (GRCm39) H598Y possibly damaging Het
Rp1l1 T G 14: 64,267,827 (GRCm39) F1138V probably benign Het
Rpgrip1l A T 8: 91,996,748 (GRCm39) F109I possibly damaging Het
Rpgrip1l T G 8: 91,987,603 (GRCm39) K818T possibly damaging Het
Rpgrip1l A T 8: 91,946,807 (GRCm39) *1265R probably null Het
Rpl12 T A 2: 32,853,031 (GRCm39) I82N possibly damaging Het
Rpl13a G C 7: 44,776,937 (GRCm39) A24G probably damaging Het
Rpp14 A C 14: 8,090,539 (GRCm38) E154D probably benign Het
Rps19 G C 7: 24,585,532 (GRCm39) probably benign Het
Rptn C A 3: 93,304,734 (GRCm39) P689H probably benign Het
Rrbp1 C A 2: 143,816,406 (GRCm39) G741V probably damaging Het
Rreb1 G A 13: 38,132,913 (GRCm39) R1696K probably benign Het
Rsl1d1 C T 16: 11,020,249 (GRCm39) G59R possibly damaging Het
Rtl1 T A 12: 109,558,753 (GRCm39) T1029S probably benign Het
Runx1 C T 16: 92,402,680 (GRCm39) A421T probably damaging Het
Runx1t1 G A 4: 13,865,892 (GRCm39) R380Q possibly damaging Het
Rxfp1 C T 3: 79,613,011 (GRCm39) G20R probably damaging Het
Ryr3 C A 2: 112,731,261 (GRCm39) G683V probably damaging Het
S100a13 C G 3: 90,423,249 (GRCm39) S80C probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 84,725,625 (GRCm39) probably benign Het
Satb1 C G 17: 52,089,967 (GRCm39) Q293H probably damaging Het
Satb1 G A 17: 52,089,980 (GRCm39) S289F probably damaging Het
Sbno1 T G 5: 124,532,021 (GRCm39) K719N possibly damaging Het
Sbno1 G T 5: 124,542,367 (GRCm39) P308T probably damaging Het
Sbpl A C 17: 24,172,518 (GRCm39) F134V probably damaging Het
Sbsn G T 7: 30,451,176 (GRCm39) E64* probably null Het
Scaf8 T G 17: 3,213,258 (GRCm39) probably benign Het
Scap A G 9: 110,201,404 (GRCm39) N131S probably damaging Het
Scarf1 C T 11: 75,416,316 (GRCm39) A586V probably damaging Het
Scd1 C A 19: 44,386,362 (GRCm39) S355I probably benign Het
Scgb2b26 A C 7: 33,643,792 (GRCm39) F49L probably benign Het
Scn11a A G 9: 119,584,308 (GRCm39) F1436L probably damaging Het
Scn7a C T 2: 66,544,295 (GRCm39) E399K probably damaging Het
Scrib G A 15: 75,920,080 (GRCm39) P1560S probably damaging Het
Sctr GT G 1: 119,964,136 (GRCm39) probably null Het
Sec16a G A 2: 26,329,105 (GRCm39) S970F probably damaging Het
Sec16b A G 1: 157,385,594 (GRCm39) probably null Het
Sec23a A G 12: 59,051,362 (GRCm39) F94L probably benign Het
Sel1l3 C A 5: 53,273,538 (GRCm39) A1081S probably damaging Het
Selenok G A 14: 29,695,401 (GRCm39) G93E probably damaging Het
Selenov G A 7: 27,990,093 (GRCm39) T137I possibly damaging Het
Sema3b A C 9: 107,476,233 (GRCm39) probably null Het
Sema3e G A 5: 14,276,470 (GRCm39) S285N probably damaging Het
Sema5b T G 16: 35,480,960 (GRCm39) F815V probably damaging Het
Serac1 G A 17: 6,099,193 (GRCm39) P533S probably damaging Het
Serpina1a C A 12: 103,820,926 (GRCm39) probably null Het
Serpinb3b T G 1: 107,085,481 (GRCm39) T87P probably damaging Het
Serpinb6c A G 13: 34,077,855 (GRCm39) F172L probably damaging Het
Serpinb6c G A 13: 34,077,906 (GRCm39) P155S probably benign Het
Serpinb6d T C 13: 33,855,237 (GRCm39) F304L possibly damaging Het
Sertad4 G T 1: 192,529,339 (GRCm39) T159N probably damaging Het
Setbp1 G C 18: 78,902,809 (GRCm39) P286R probably damaging Het
Sez6 T G 11: 77,864,023 (GRCm39) F502V possibly damaging Het
Sez6l T G 5: 112,588,781 (GRCm39) Q644P probably damaging Het
Sfmbt2 A C 2: 10,583,994 (GRCm39) T784P probably damaging Het
Sgo2b T G 8: 64,381,456 (GRCm39) T459P possibly damaging Het
Sgo2b C A 8: 64,380,039 (GRCm39) G931V probably damaging Het
Sgtb T C 13: 104,268,447 (GRCm39) L118P probably damaging Het
Shank1 C T 7: 44,001,590 (GRCm39) A1103V unknown Het
Siglech A G 7: 55,418,742 (GRCm39) I182V possibly damaging Het
Sirpa C A 2: 129,460,455 (GRCm39) A54D probably damaging Het
Slamf1 T G 1: 171,627,160 (GRCm39) V334G probably damaging Het
Slc14a2 T G 18: 78,238,995 (GRCm39) K208T probably damaging Het
Slc15a1 C T 14: 121,717,466 (GRCm39) R272Q probably benign Het
Slc15a1 A G 14: 121,728,456 (GRCm39) L65P probably damaging Het
Slc15a2 A G 16: 36,772,445 (GRCm38) M179T probably benign Het
Slc1a5 C T 7: 16,531,594 (GRCm39) P533L probably damaging Het
Slc22a12 G A 19: 6,588,493 (GRCm39) H342Y possibly damaging Het
Slc22a2 G A 17: 12,833,663 (GRCm39) E448K probably benign Het
Slc22a28 A C 19: 8,039,763 (GRCm39) S537A probably damaging Het
Slc22a3 A T 17: 12,644,568 (GRCm39) C472* probably null Het
Slc22a30 C A 19: 8,313,139 (GRCm39) V549F probably damaging Het
Slc22a6 A G 19: 8,599,197 (GRCm39) D276G probably benign Het
Slc23a1 T C 18: 35,757,561 (GRCm39) N237D probably benign Het
Slc25a1 C G 16: 17,745,070 (GRCm39) G130A probably benign Het
Slc28a1 C G 7: 80,787,916 (GRCm39) P268A probably damaging Het
Slc2a6 G A 2: 26,911,999 (GRCm39) P420L probably damaging Het
Slc35a4 A C 18: 36,816,146 (GRCm39) *325Y probably null Het
Slc48a1 C A 15: 97,688,562 (GRCm39) Y74* probably null Het
Slc4a10 T G 2: 62,058,915 (GRCm39) L141V probably damaging Het
Slc4a8 C G 15: 100,659,832 (GRCm39) P8A probably benign Het
Slc6a19 C T 13: 73,837,849 (GRCm39) E217K possibly damaging Het
Slc6a5 C G 7: 49,561,605 (GRCm39) P46A probably benign Het
Slc7a14 G C 3: 31,278,148 (GRCm39) L486V probably benign Het
Slco2a1 C A 9: 102,956,726 (GRCm39) L513M probably benign Het
Slit2 A G 5: 48,459,695 (GRCm39) Y1308C probably damaging Het
Slurp2 C A 15: 74,614,950 (GRCm39) V64L probably damaging Het
Slx9 C A 10: 77,325,865 (GRCm39) S168I probably damaging Het
Smad5 A T 13: 56,876,441 (GRCm39) R258S probably benign Het
Smarcc2 G C 10: 128,297,303 (GRCm39) G65A probably damaging Het
Smco1 A T 16: 32,092,033 (GRCm39) D37V probably damaging Het
Smg1 A C 7: 117,753,858 (GRCm39) probably benign Het
Smg1 A G 7: 117,777,622 (GRCm39) L1358P possibly damaging Het
Smg1 C A 7: 117,767,884 (GRCm39) E1665* probably null Het
Smim29 G A 17: 27,783,215 (GRCm39) R51C possibly damaging Het
Snx15 T C 19: 6,171,441 (GRCm39) E211G probably damaging Het
Snx5 C T 2: 144,094,411 (GRCm39) R373Q probably benign Het
Sod2 T A 17: 13,232,425 (GRCm39) L150H probably damaging Het
Sorcs1 C G 19: 50,210,581 (GRCm39) Q761H probably benign Het
Sox12 C G 2: 152,239,385 (GRCm39) W78C probably damaging Het
Sox17 G T 1: 4,562,525 (GRCm39) S160Y probably damaging Het
Sp9 G C 2: 73,103,574 (GRCm39) A43P possibly damaging Het
Spag17 A G 3: 100,002,946 (GRCm39) K1890R probably benign Het
Speer1c T C 5: 10,293,097 (GRCm39) probably benign Het
Speer4b C G 5: 27,702,939 (GRCm39) E188D probably benign Het
Speer4f1 A C 5: 17,684,477 (GRCm39) E168D probably damaging Het
Spen C A 4: 141,205,287 (GRCm39) E1113D unknown Het
Spen T C 4: 141,205,288 (GRCm39) E1113G unknown Het
Sphkap T G 1: 83,256,325 (GRCm39) T475P probably damaging Het
Sphkap T A 1: 83,254,329 (GRCm39) N1140I probably damaging Het
Spinkl G C 18: 44,307,626 (GRCm39) L12V probably damaging Het
Spire1 C A 18: 67,628,222 (GRCm39) R509L possibly damaging Het
Spon1 G A 7: 113,365,623 (GRCm39) A20T possibly damaging Het
Srd5a3 T C 5: 76,297,668 (GRCm39) F33L possibly damaging Het
Srebf2 T G 15: 82,079,122 (GRCm39) F783L probably benign Het
Srp68 TCCGCCGCCGCCGCCGC TCCGCCGCCGCCGCCGCCGCCGC 11: 116,164,861 (GRCm39) probably benign Het
Ssbp4 A C 8: 71,052,485 (GRCm39) probably benign Het
Ssc5d A C 7: 4,931,433 (GRCm39) E213D probably damaging Het
Ssh2 C A 11: 77,340,321 (GRCm39) T491N probably damaging Het
Ssrp1 G A 2: 84,870,997 (GRCm39) R211H probably damaging Het
Ssxb3 T G X: 8,455,427 (GRCm39) S5R probably benign Het
Stam C A 2: 14,143,901 (GRCm39) S397* probably null Het
Stambpl1 A T 19: 34,204,027 (GRCm39) N39I probably damaging Het
Stap2 G C 17: 56,306,748 (GRCm39) A275G probably benign Het
Stard4 T C 18: 33,336,773 (GRCm39) S181G probably benign Het
Stard4 G T 18: 33,336,770 (GRCm39) Q182K probably benign Het
Stil T G 4: 114,863,890 (GRCm39) L44R probably damaging Het
Stk31 G T 6: 49,394,122 (GRCm39) probably null Het
Ston2 T G 12: 91,615,841 (GRCm39) N189T possibly damaging Het
Stxbp5l T G 16: 37,024,851 (GRCm39) Q582H probably benign Het
Styxl2 A G 1: 165,926,852 (GRCm39) L920P probably damaging Het
Sult2a1 T C 7: 13,535,339 (GRCm39) Q238R probably benign Het
Sult2a1 A T 7: 13,535,360 (GRCm39) F231Y probably benign Het
Sult2a1 T C 7: 13,537,961 (GRCm39) I187M probably benign Het
Sult2a6 T C 7: 13,959,819 (GRCm39) Q238R probably benign Het
Sycp2 C T 2: 178,023,727 (GRCm39) V430I probably benign Het
Sycp2 T G 2: 178,016,160 (GRCm39) E767D probably benign Het
Syna C T 5: 134,587,383 (GRCm39) R522Q probably benign Het
Syne4 C G 7: 30,015,761 (GRCm39) S125C probably damaging Het
Syngap1 A C 17: 27,180,550 (GRCm39) D653A probably damaging Het
Synm A C 7: 67,401,634 (GRCm39) L285V probably damaging Het
Synpo2l T G 14: 20,716,035 (GRCm39) E183D probably damaging Het
Syt10 C T 15: 89,725,842 (GRCm39) G44D probably benign Het
Szrd1 C A 4: 140,845,898 (GRCm39) R99L probably damaging Het
Taar9 G C 10: 23,984,863 (GRCm39) C190W probably damaging Het
Tab2 A T 10: 7,796,030 (GRCm39) S77T possibly damaging Het
Taf1a G T 1: 183,185,614 (GRCm39) R291M possibly damaging Het
Taf5l C A 8: 124,724,077 (GRCm39) G581* probably null Het
Tars1 G T 15: 11,391,970 (GRCm39) P255H probably benign Het
Tas1r2 C T 4: 139,387,735 (GRCm39) A398V possibly damaging Het
Tas2r109 T C 6: 132,957,264 (GRCm39) Q222R probably benign Het
Tas2r115 G T 6: 132,714,044 (GRCm39) C302* probably null Het
Tas2r116 A G 6: 132,832,911 (GRCm39) N171D probably benign Het
Tbc1d1 A G 5: 64,432,736 (GRCm39) probably null Het
Tbc1d13 T C 2: 30,024,884 (GRCm39) probably null Het
Tbc1d4 A C 14: 101,689,859 (GRCm39) V1049G probably damaging Het
Tbc1d5 C A 17: 51,270,724 (GRCm39) R169I probably damaging Het
Tbxa2r G C 10: 81,169,049 (GRCm39) G246A probably damaging Het
Tcaim A C 9: 122,662,722 (GRCm39) K430T probably benign Het
Tchh C T 3: 93,352,989 (GRCm39) Q810* probably null Het
Tcp10a G C 17: 7,593,848 (GRCm39) A58P probably damaging Het
Tctn1 C G 5: 122,389,704 (GRCm39) A273P probably damaging Het
Tctn3 A C 19: 40,595,790 (GRCm39) F332V possibly damaging Het
Tdrd6 T G 17: 43,937,409 (GRCm39) E1213A probably benign Het
Tead4 G C 6: 128,247,867 (GRCm39) R57G probably damaging Het
Teddm1a G A 1: 153,767,772 (GRCm39) G79R probably benign Het
Tekt5 G A 16: 10,176,241 (GRCm39) R435W probably damaging Het
Tenm1 G A X: 41,988,712 (GRCm39) P290S probably damaging Het
Tenm2 C T 11: 36,164,094 (GRCm39) A384T probably damaging Het
Terf2 A G 8: 107,807,855 (GRCm39) L240P probably damaging Het
Tex13c2 A T X: 41,579,439 (GRCm39) S211C probably damaging Het
Tex15 A C 8: 34,061,343 (GRCm39) K532Q possibly damaging Het
Tex15 A G 8: 34,064,898 (GRCm39) N1443D probably benign Het
Tex15 A G 8: 34,061,838 (GRCm39) I697V possibly damaging Het
Them6 G A 15: 74,593,418 (GRCm39) R92H probably benign Het
Thsd1 G A 8: 22,742,235 (GRCm39) R301H probably damaging Het
Thumpd3 C G 6: 113,032,991 (GRCm39) T243S probably benign Het
Tiam2 C T 17: 3,465,294 (GRCm39) S341F probably benign Het
Tie1 A G 4: 118,341,626 (GRCm39) C229R probably damaging Het
Timm44 C T 8: 4,318,004 (GRCm39) E135K probably benign Het
Tlr11 T G 14: 50,599,795 (GRCm39) F594V possibly damaging Het
Tlr4 G A 4: 66,847,319 (GRCm39) D149N probably benign Het
Tm9sf3 A G 19: 41,220,817 (GRCm39) Y382H probably damaging Het
Tm9sf5 A C X: 56,533,998 (GRCm39) I668L probably benign Het
Tmc3 A C 7: 83,252,676 (GRCm39) K359T probably damaging Het
Tmem132a G A 19: 10,836,299 (GRCm39) R744C probably damaging Het
Tmem132c G A 5: 127,581,985 (GRCm39) S400N probably benign Het
Tmem198 C A 1: 75,456,906 (GRCm39) Q11K probably benign Het
Tmem219 G C 7: 126,490,846 (GRCm39) P198A possibly damaging Het
Tmem270 A C 5: 134,935,510 (GRCm39) L15R probably damaging Het
Tmem39a C A 16: 38,396,140 (GRCm39) F124L possibly damaging Het
Tmem39b C G 4: 129,586,270 (GRCm39) A4P probably benign Het
Tmem45b A G 9: 31,339,323 (GRCm39) F131L probably damaging Het
Tmppe G A 9: 114,234,145 (GRCm39) R148H probably benign Het
Tmprss4 T A 9: 45,086,763 (GRCm39) N333Y probably damaging Het
Tnni3k G C 3: 154,645,307 (GRCm39) A526G probably damaging Het
Tnpo1 C G 13: 98,997,178 (GRCm39) G417A probably benign Het
Tnpo3 C G 6: 29,565,842 (GRCm39) G504A probably benign Het
Tnr T C 1: 159,722,665 (GRCm39) F1037L probably benign Het
Tnrc6b C T 15: 80,811,891 (GRCm39) R813* probably null Het
Togaram2 A G 17: 72,021,275 (GRCm39) K687R possibly damaging Het
Tox C A 4: 6,688,450 (GRCm39) R519M probably damaging Het
Tpo T C 12: 30,144,781 (GRCm39) D656G probably damaging Het
Trank1 G A 9: 111,193,778 (GRCm39) D601N probably damaging Het
Trav13d-4 C G 14: 53,310,627 (GRCm39) T76S probably benign Het
Trav16n C T 14: 53,589,030 (GRCm39) A101V possibly damaging Het
Trav5-4 A G 14: 53,941,696 (GRCm39) E23G possibly damaging Het
Trav8d-2 T G 14: 53,280,265 (GRCm39) L85R probably damaging Het
Tril G A 6: 53,795,905 (GRCm39) T439M probably benign Het
Trim30a C A 7: 104,084,861 (GRCm39) W116C probably damaging Het
Trim30b C A 7: 104,015,307 (GRCm39) S27I probably damaging Het
Trim42 T G 9: 97,251,675 (GRCm39) N75H probably benign Het
Trim43c A C 9: 88,724,988 (GRCm39) probably null Het
Trim45 A C 3: 100,832,956 (GRCm39) E396D probably benign Het
Trim5 C T 7: 103,915,432 (GRCm39) A294T possibly damaging Het
Trim67 A G 8: 125,543,780 (GRCm39) Q380R probably damaging Het
Triml1 T A 8: 43,583,435 (GRCm39) I389F probably damaging Het
Trip12 A C 1: 84,743,889 (GRCm39) N500K probably damaging Het
Trip4 G A 9: 65,771,697 (GRCm39) R278* probably null Het
Trp53bp1 T C 2: 121,084,126 (GRCm39) K247E probably benign Het
Trp63 G A 16: 25,582,063 (GRCm39) R37K probably benign Het
Trpm7 G T 2: 126,639,201 (GRCm39) A1711E probably damaging Het
Trrap A G 5: 144,771,007 (GRCm39) K2802R probably benign Het
Tspan5 G C 3: 138,604,087 (GRCm39) W228C possibly damaging Het
Tssk4 A G 14: 55,888,380 (GRCm39) K83R probably damaging Het
Ttbk1 C A 17: 46,757,251 (GRCm39) A1128S probably benign Het
Ttc16 C A 2: 32,659,345 (GRCm39) L251F probably damaging Het
Ttc23l C A 15: 10,533,753 (GRCm39) R263S probably damaging Het
Ttc28 G C 5: 111,434,181 (GRCm39) G2405A probably benign Het
Ttc39c G T 18: 12,820,020 (GRCm39) M15I possibly damaging Het
Ttll1 C T 15: 83,382,390 (GRCm39) V201I probably damaging Het
Ttll12 T C 15: 83,466,279 (GRCm39) Q394R probably damaging Het
Ttll2 T G 17: 7,618,925 (GRCm39) D334A probably damaging Het
Ttn T G 2: 76,678,669 (GRCm39) probably benign Het
Ttn T G 2: 76,617,613 (GRCm39) K14540T probably damaging Het
Ttn A G 2: 76,582,863 (GRCm39) W20931R probably damaging Het
Ttn G T 2: 76,582,574 (GRCm39) A14446E probably damaging Het
Ttn C G 2: 76,577,295 (GRCm39) E24533Q probably damaging Het
Ttn T G 2: 76,569,031 (GRCm39) E25541D possibly damaging Het
Tubal3 A C 13: 3,983,511 (GRCm39) E430D probably benign Het
Tubb3 G C 8: 124,148,273 (GRCm39) G402A probably damaging Het
Tubd1 A T 11: 86,445,993 (GRCm39) K211M probably damaging Het
Tubd1 G A 11: 86,440,296 (GRCm39) G107S probably damaging Het
Tubgcp5 G A 7: 55,464,849 (GRCm39) G577S probably benign Het
Tulp2 A C 7: 45,171,410 (GRCm39) K404T probably damaging Het
Tyro3 T G 2: 119,639,948 (GRCm39) I377S probably benign Het
Ube4b A G 4: 149,419,582 (GRCm39) I1042T possibly damaging Het
Ubl4b T G 3: 107,461,719 (GRCm39) E180D unknown Het
Ubqln5 T A 7: 103,778,178 (GRCm39) K215N possibly damaging Het
Ubqlnl A G 7: 103,799,200 (GRCm39) V99A probably damaging Het
Ubr3 A G 2: 69,752,711 (GRCm39) T322A probably benign Het
Uggt1 A C 1: 36,213,272 (GRCm39) F861C probably damaging Het
Ugt1a10 T C 1: 87,983,564 (GRCm39) F121L probably benign Het
Umps CCTGACTGA CCTGA 16: 33,787,195 (GRCm39) probably null Het
Unc13a C A 8: 72,107,447 (GRCm39) probably null Het
Unc5c T G 3: 141,439,661 (GRCm39) L111V probably damaging Het
Unc79 C A 12: 102,987,271 (GRCm39) H187N probably damaging Het
Unc80 C G 1: 66,685,610 (GRCm39) P2245A possibly damaging Het
Ush2a T C 1: 188,644,180 (GRCm39) L4514P probably benign Het
Ush2a A C 1: 188,679,201 (GRCm39) N4803T probably benign Het
Usp17lb G A 7: 104,490,336 (GRCm39) P197L probably benign Het
Usp43 C A 11: 67,746,866 (GRCm39) R942L probably benign Het
Usp51 C T X: 151,791,218 (GRCm39) P271S probably benign Het
Usp51 C T X: 151,791,219 (GRCm39) P271L probably benign Het
Vmn1r12 T G 6: 57,135,966 (GRCm39) L21R probably damaging Het
Vmn1r176 C T 7: 23,534,598 (GRCm39) R185H probably benign Het
Vmn1r179 A G 7: 23,627,907 (GRCm39) I33V probably benign Het
Vmn1r188 T C 13: 22,272,450 (GRCm39) W135R probably damaging Het
Vmn1r212 A C 13: 23,067,932 (GRCm39) F134V probably damaging Het
Vmn1r229 C A 17: 21,035,327 (GRCm39) L191M probably damaging Het
Vmn1r232 C A 17: 21,134,100 (GRCm39) V167F probably benign Het
Vmn1r4 G A 6: 56,934,050 (GRCm39) V185M possibly damaging Het
Vmn1r46 A G 6: 89,953,723 (GRCm39) R191G probably damaging Het
Vmn1r72 T G 7: 11,404,100 (GRCm39) N116T probably benign Het
Vmn1r78 A C 7: 11,886,641 (GRCm39) K84T probably damaging Het
Vmn2r10 A G 5: 109,143,979 (GRCm39) F657S probably damaging Het
Vmn2r101 C A 17: 19,809,237 (GRCm39) A122D possibly damaging Het
Vmn2r103 C A 17: 20,015,309 (GRCm39) S483Y probably benign Het
Vmn2r108 C T 17: 20,691,375 (GRCm39) V383M probably benign Het
Vmn2r110 T G 17: 20,803,942 (GRCm39) H211P probably damaging Het
Vmn2r112 C G 17: 22,824,059 (GRCm39) S438C possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r12 G T 5: 109,240,646 (GRCm39) H156N probably benign Het
Vmn2r16 TA T 5: 109,511,779 (GRCm39) probably null Het
Vmn2r16 A C 5: 109,488,381 (GRCm39) Q418P probably benign Het
Vmn2r19 T G 6: 123,285,298 (GRCm39) L3V probably benign Het
Vmn2r23 A C 6: 123,719,067 (GRCm39) T807P probably damaging Het
Vmn2r24 A C 6: 123,781,155 (GRCm39) S454R probably benign Het
Vmn2r45 T A 7: 8,474,484 (GRCm39) E848V probably benign Het
Vmn2r5 T G 3: 64,416,963 (GRCm39) N65T probably benign Het
Vmn2r50 G C 7: 9,771,427 (GRCm39) T758R possibly damaging Het
Vmn2r50 G T 7: 9,780,086 (GRCm39) L432I probably benign Het
Vmn2r59 G T 7: 41,661,838 (GRCm39) A659E possibly damaging Het
Vmn2r61 A G 7: 41,949,388 (GRCm39) T603A possibly damaging Het
Vmn2r63 G A 7: 42,577,983 (GRCm39) T185I probably benign Het
Vmn2r65 C A 7: 84,592,473 (GRCm39) probably null Het
Vmn2r70 A C 7: 85,213,968 (GRCm39) L395V possibly damaging Het
Vmn2r79 T G 7: 86,651,549 (GRCm39) F316C probably damaging Het
Vmn2r8 A C 5: 108,949,864 (GRCm39) F328V probably damaging Het
Vmn2r82 T G 10: 79,192,456 (GRCm39) F11C probably damaging Het
Vmn2r87 C A 10: 130,308,183 (GRCm39) R685M probably damaging Het
Vmn2r90 C A 17: 17,953,879 (GRCm39) A681E probably damaging Het
Vmn2r93 A C 17: 18,546,665 (GRCm39) K846Q probably damaging Het
Vmn2r95 C A 17: 18,660,663 (GRCm39) F358L probably benign Het
Vmn2r96 T A 17: 18,817,628 (GRCm39) L594I possibly damaging Het
Vmn2r99 C A 17: 19,599,563 (GRCm39) Q416K probably benign Het
Vmo1 T A 11: 70,404,643 (GRCm39) L119F probably damaging Het
Vps13c T C 9: 67,821,257 (GRCm39) S1256P probably damaging Het
Vwa8 C T 14: 79,219,686 (GRCm39) A478V probably benign Het
Washc4 C G 10: 83,412,605 (GRCm39) A749G probably benign Het
Wbp2 T A 11: 115,977,739 (GRCm39) K5* probably null Het
Wdcp A C 12: 4,900,825 (GRCm39) K227T probably damaging Het
Wdr13 A C X: 7,991,861 (GRCm39) F369V probably damaging Het
Wdr13 C A X: 7,991,863 (GRCm39) S460I probably damaging Het
Wdr3 T G 3: 100,051,660 (GRCm39) K663T probably benign Het
Wdr36 T G 18: 32,999,065 (GRCm39) probably null Het
Wdr53 T A 16: 32,071,116 (GRCm39) S154T probably damaging Het
Wdr5b G A 16: 35,862,813 (GRCm39) A311T probably damaging Het
Wdr64 A T 1: 175,533,551 (GRCm39) Q62H possibly damaging Het
Wdr82 A C 9: 106,061,999 (GRCm39) I221L probably benign Het
Wnt5a C T 14: 28,244,685 (GRCm39) R311C probably damaging Het
Wrap53 G A 11: 69,469,324 (GRCm39) S144F probably damaging Het
Wsb2 C A 5: 117,515,571 (GRCm39) P392Q probably damaging Het
Wwc1 T G 11: 35,774,309 (GRCm39) N317T possibly damaging Het
Wwp2 G A 8: 108,281,719 (GRCm39) E303K probably damaging Het
Xdh C T 17: 74,193,423 (GRCm39) S1291N probably benign Het
Xirp1 T G 9: 120,016,907 (GRCm38) Q970P probably benign Het
Xirp2 A G 2: 67,343,665 (GRCm39) T1969A probably benign Het
Xpot A C 10: 121,437,228 (GRCm39) I830S probably damaging Het
Xylb T A 9: 119,210,680 (GRCm39) L388M probably benign Het
Yju2b G A 8: 84,985,538 (GRCm39) R244* probably null Het
Ylpm1 G A 12: 85,076,929 (GRCm39) R760K possibly damaging Het
Zbtb34 C G 2: 33,301,120 (GRCm39) E474Q probably damaging Het
Zc3h12b A C X: 94,943,048 (GRCm39) K116T probably damaging Het
Zdhhc17 T C 10: 110,781,327 (GRCm39) probably null Het
Zfat G A 15: 68,058,950 (GRCm39) A195V probably benign Het
Zfhx2 T G 14: 55,311,637 (GRCm39) Q352H possibly damaging Het
Zfhx3 A C 8: 109,677,989 (GRCm39) K3013T possibly damaging Het
Zfp106 G T 2: 120,360,971 (GRCm39) L1047I probably damaging Het
Zfp109 A G 7: 23,928,360 (GRCm39) F358L probably benign Het
Zfp157 T C 5: 138,455,461 (GRCm39) L553P probably damaging Het
Zfp273 A T 13: 67,973,513 (GRCm39) I214F possibly damaging Het
Zfp326 T A 5: 106,036,496 (GRCm39) Y136N probably damaging Het
Zfp386 G A 12: 116,018,393 (GRCm39) E21K possibly damaging Het
Zfp42 C G 8: 43,748,842 (GRCm39) V220L probably benign Het
Zfp507 C G 7: 35,493,702 (GRCm39) S447T possibly damaging Het
Zfp518b C A 5: 38,831,636 (GRCm39) S123I probably damaging Het
Zfp541 A C 7: 15,813,720 (GRCm39) K791T probably benign Het
Zfp553 G T 7: 126,834,670 (GRCm39) G75V probably damaging Het
Zfp57 T C 17: 37,321,030 (GRCm39) F295L probably damaging Het
Zfp593 G C 4: 133,972,753 (GRCm39) A21G probably benign Het
Zfp598 CCAT CCATCAT 17: 24,899,184 (GRCm39) probably benign Het
Zfp638 A C 6: 83,921,793 (GRCm39) K640T probably damaging Het
Zfp648 T C 1: 154,080,266 (GRCm39) F142L probably benign Het
Zfp729b C T 13: 67,741,189 (GRCm39) E359K possibly damaging Het
Zfp775 G A 6: 48,597,622 (GRCm39) E499K probably damaging Het
Zfp868 TTAT TT 8: 70,064,561 (GRCm39) probably null Het
Zfp959 A G 17: 56,205,135 (GRCm39) R391G probably damaging Het
Zfp976 T G 7: 42,262,184 (GRCm39) E551A possibly damaging Het
Zfp997 A G 13: 66,270,208 (GRCm39) K458R probably damaging Het
Zfp998 A C 13: 66,579,245 (GRCm39) C413G probably damaging Het
Zfp998 C T 13: 66,579,800 (GRCm39) G228S probably benign Het
Zfp999 C A 13: 66,375,170 (GRCm39) S73I probably benign Het
Zfx A C X: 93,123,049 (GRCm39) L585V probably damaging Het
Zglp1 C T 9: 20,978,296 (GRCm39) R27Q possibly damaging Het
Zhx3 GGAAG GG 2: 160,621,675 (GRCm39) probably benign Het
Zic2 A T 14: 122,716,087 (GRCm39) H403L probably damaging Het
Zim1 T G 7: 6,680,658 (GRCm39) N335T possibly damaging Het
Zkscan3 T C 13: 21,572,735 (GRCm39) K299R possibly damaging Het
Zkscan4 T G 13: 21,668,067 (GRCm39) L173V probably damaging Het
Zmiz2 A T 11: 6,349,603 (GRCm39) H421L probably damaging Het
Zmynd15 A C 11: 70,351,961 (GRCm39) K60T possibly damaging Het
Zmynd8 A C 2: 165,670,091 (GRCm39) L481R probably benign Het
Zpbp C A 11: 11,358,568 (GRCm39) R233L probably damaging Het
Zscan18 G T 7: 12,508,994 (GRCm39) Q169K probably benign Het
Zscan18 G A 7: 12,509,020 (GRCm39) probably benign Het
Zscan26 T G 13: 21,629,633 (GRCm39) K290T probably damaging Het
Other mutations in Psg25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Psg25 APN 7 18,260,106 (GRCm39) splice site probably benign
IGL00508:Psg25 APN 7 18,263,656 (GRCm39) missense probably benign
IGL01154:Psg25 APN 7 18,258,624 (GRCm39) missense probably benign 0.01
IGL01388:Psg25 APN 7 18,263,590 (GRCm39) missense possibly damaging 0.87
IGL02222:Psg25 APN 7 18,263,652 (GRCm39) missense probably damaging 1.00
IGL02261:Psg25 APN 7 18,255,268 (GRCm39) missense probably benign 0.09
IGL02309:Psg25 APN 7 18,260,349 (GRCm39) missense probably damaging 0.98
IGL02803:Psg25 APN 7 18,260,212 (GRCm39) missense possibly damaging 0.47
IGL03334:Psg25 APN 7 18,263,699 (GRCm39) missense probably benign 0.01
R0711:Psg25 UTSW 7 18,263,485 (GRCm39) nonsense probably null
R1458:Psg25 UTSW 7 18,263,512 (GRCm39) missense probably damaging 1.00
R1598:Psg25 UTSW 7 18,265,928 (GRCm39) nonsense probably null
R2064:Psg25 UTSW 7 18,255,178 (GRCm39) missense probably damaging 0.96
R2066:Psg25 UTSW 7 18,263,487 (GRCm39) missense probably damaging 1.00
R4485:Psg25 UTSW 7 18,260,203 (GRCm39) missense probably damaging 1.00
R4499:Psg25 UTSW 7 18,258,816 (GRCm39) missense possibly damaging 0.89
R4514:Psg25 UTSW 7 18,263,533 (GRCm39) nonsense probably null
R4547:Psg25 UTSW 7 18,258,629 (GRCm39) missense probably damaging 1.00
R4604:Psg25 UTSW 7 18,263,728 (GRCm39) missense probably benign 0.05
R4886:Psg25 UTSW 7 18,258,838 (GRCm39) missense probably benign 0.00
R5121:Psg25 UTSW 7 18,260,461 (GRCm39) missense possibly damaging 0.68
R5208:Psg25 UTSW 7 18,260,460 (GRCm39) missense probably benign 0.00
R5267:Psg25 UTSW 7 18,258,711 (GRCm39) missense possibly damaging 0.78
R5376:Psg25 UTSW 7 18,260,460 (GRCm39) missense probably benign 0.00
R5425:Psg25 UTSW 7 18,258,709 (GRCm39) nonsense probably null
R5749:Psg25 UTSW 7 18,258,776 (GRCm39) missense probably damaging 1.00
R6050:Psg25 UTSW 7 18,260,403 (GRCm39) missense probably benign 0.37
R6862:Psg25 UTSW 7 18,255,323 (GRCm39) missense probably benign 0.03
R6962:Psg25 UTSW 7 18,263,679 (GRCm39) missense probably damaging 1.00
R7238:Psg25 UTSW 7 18,266,127 (GRCm39) start gained probably benign
R7782:Psg25 UTSW 7 18,255,227 (GRCm39) missense probably benign 0.15
R7812:Psg25 UTSW 7 18,255,093 (GRCm39) missense possibly damaging 0.71
R8155:Psg25 UTSW 7 18,260,445 (GRCm39) missense probably benign 0.00
R8775:Psg25 UTSW 7 18,255,153 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Psg25 UTSW 7 18,255,153 (GRCm39) missense probably damaging 1.00
R8865:Psg25 UTSW 7 18,263,519 (GRCm39) missense possibly damaging 0.71
R9013:Psg25 UTSW 7 18,258,690 (GRCm39) missense probably benign 0.02
R9755:Psg25 UTSW 7 18,260,460 (GRCm39) missense probably benign 0.00
Predicted Primers
Posted On 2017-02-27