Incidental Mutation 'Z1088:Nlrp5'
ID 458833
Institutional Source Beutler Lab
Gene Symbol Nlrp5
Ensembl Gene ENSMUSG00000015721
Gene Name NLR family, pyrin domain containing 5
Synonyms Mater, Op1, Nalp5
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # Z1088 ()
Quality Score 186
Status Not validated
Chromosome 7
Chromosomal Location 23085314-23141347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23117011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 245 (L245P)
Ref Sequence ENSEMBL: ENSMUSP00000118638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015866] [ENSMUST00000086341] [ENSMUST00000108441] [ENSMUST00000133237] [ENSMUST00000139661]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000015866
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015866
Gene: ENSMUSG00000015721
AA Change: L245P

Pfam:NACHT 191 359 3.5e-45 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1031 6.04e1 SMART
LRR 1032 1059 1.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086341
AA Change: L229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083524
Gene: ENSMUSG00000015721
AA Change: L229P

Pfam:NACHT 175 343 1.5e-44 PFAM
LRR 675 702 4.51e1 SMART
LRR 731 758 1.36e-2 SMART
LRR 760 787 6.79e0 SMART
LRR 788 815 4.3e0 SMART
LRR 817 844 1.42e0 SMART
LRR 845 872 1.2e-3 SMART
LRR 874 901 1.2e2 SMART
LRR 902 929 2.2e-2 SMART
LRR 931 958 1.56e2 SMART
LRR 959 986 3.36e-7 SMART
LRR 988 1015 6.04e1 SMART
LRR 1016 1043 1.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108441
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104080
Gene: ENSMUSG00000015721
AA Change: L245P

Pfam:NACHT 191 359 1.5e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1033 1.28e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133237
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122007
Gene: ENSMUSG00000015721
AA Change: L245P

Pfam:NACHT 191 359 1.3e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139661
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118638
Gene: ENSMUSG00000015721
AA Change: L245P

Pfam:NACHT 191 359 1.6e-44 PFAM
Blast:LRR 691 718 8e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207536
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.2%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NACHT, leucine-rich repeat, and pyrin domain containing family. Members of this family have a pyrin domain at the N-terminus, a central NACHT domain, and a C-terminal leucine-rich repeat domain. This gene encodes a maternal-effect factor that is essential for early embryonic development in the mouse. Homozygous null mutant females are sterile, and embryos die following the first cleavage. This gene is required for endoplasmic reticulum redistribution and calcium homeostasis in oocytes. In addition, ovulated oocytes mutant for this gene have abnormal mitochondrial localization and increased mitochondrial activity, which results in mitochondrial damage and early embryonic lethality. Pseudogenes of this gene have been found on chromosomes 7 and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Females lacking this maternal effect gene are sterile. Preimplantation embryos do not develop past the 2-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 1505 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik T C 6: 32,035,427 (GRCm39) W36R probably damaging Het
1700016H13Rik G A 5: 103,797,434 (GRCm39) P25L probably damaging Het
1700017N19Rik A T 10: 100,441,501 (GRCm39) K170M probably damaging Het
1700020A23Rik C T 2: 130,247,772 (GRCm39) P77L probably damaging Het
1700020L24Rik A G 11: 83,331,332 (GRCm39) Q81R probably damaging Het
2210408I21Rik A C 13: 77,323,010 (GRCm39) D13A probably damaging Het
2310003L06Rik G T 5: 88,120,165 (GRCm39) Q307H probably damaging Het
2510039O18Rik G A 4: 148,029,202 (GRCm39) E391K probably benign Het
4930447C04Rik G C 12: 72,986,169 (GRCm39) probably benign Het
4932438H23Rik T A 16: 90,852,701 (GRCm39) H145L probably benign Het
4933405L10Rik G A 8: 106,436,395 (GRCm39) G197E probably damaging Het
A4gnt C T 9: 99,495,894 (GRCm39) S110L probably damaging Het
Aadacl4fm1 C A 4: 144,255,239 (GRCm39) L220M probably damaging Het
Aasdh T C 5: 77,049,004 (GRCm39) probably null Het
Abca13 A C 11: 9,244,687 (GRCm39) Q2183H probably damaging Het
Abca14 T A 7: 119,815,358 (GRCm39) I202N probably benign Het
Abca17 T A 17: 24,498,053 (GRCm39) K1428M probably damaging Het
Abca17 C G 17: 24,565,193 (GRCm39) A80P probably damaging Het
Abca17 G T 17: 24,498,081 (GRCm39) P1419T probably benign Het
Abca8b A T 11: 109,867,308 (GRCm39) M250K probably benign Het
Abcc1 C A 16: 14,228,673 (GRCm39) H307N probably benign Het
Abcc12 G A 8: 87,286,908 (GRCm39) probably null Het
Abcc8 A G 7: 45,787,489 (GRCm39) F571L probably benign Het
Abhd8 G A 8: 71,914,445 (GRCm39) P61L probably benign Het
Abtb3 C T 10: 85,223,721 (GRCm39) H177Y probably benign Het
Acan G T 7: 78,737,948 (GRCm39) E218* probably null Het
Acan A C 7: 78,761,102 (GRCm39) H1938P probably benign Het
Acan G C 7: 78,749,858 (GRCm39) S1543T probably benign Het
Accsl A C 2: 93,696,293 (GRCm39) F106V probably benign Het
Acnat1 T G 4: 49,447,588 (GRCm39) K313T probably damaging Het
Acot8 T C 2: 164,641,733 (GRCm39) Q133R probably damaging Het
Acox3 A T 5: 35,745,566 (GRCm39) K18M probably damaging Het
Acoxl A C 2: 127,714,115 (GRCm39) D137A probably damaging Het
Acsm5 A T 7: 119,136,434 (GRCm39) K335M probably damaging Het
Actn4 A C 7: 28,594,003 (GRCm39) F855V probably damaging Het
Acvr2a T C 2: 48,760,385 (GRCm39) V47A probably benign Het
Ada C G 2: 163,570,036 (GRCm39) probably null Het
Adam21 G A 12: 81,607,460 (GRCm39) H101Y probably damaging Het
Adam26a T A 8: 44,022,735 (GRCm39) N252Y probably damaging Het
Adam26b T C 8: 43,973,634 (GRCm39) E456G probably damaging Het
Adam3 C A 8: 25,171,447 (GRCm39) probably benign Het
Adamts14 A G 10: 61,054,224 (GRCm39) F603L probably damaging Het
Adamts18 T C 8: 114,502,072 (GRCm39) K263R possibly damaging Het
Adamts3 G A 5: 89,832,308 (GRCm39) R932C probably damaging Het
Adamtsl3 T C 7: 82,189,533 (GRCm39) S586P probably damaging Het
Adamtsl3 T G 7: 82,148,922 (GRCm39) F319V probably damaging Het
Adcy1 G C 11: 7,100,019 (GRCm39) A710P probably benign Het
Adcy4 G A 14: 56,018,413 (GRCm39) A178V probably benign Het
Add1 T A 5: 34,770,744 (GRCm39) L285* probably null Het
Add2 G C 6: 86,062,947 (GRCm39) R35P probably damaging Het
Adgrb3 C T 1: 25,170,352 (GRCm39) R982H probably damaging Het
Adgrf3 T G 5: 30,404,118 (GRCm39) K378T possibly damaging Het
Adgrl3 A T 5: 81,660,005 (GRCm39) D258V probably damaging Het
Adgrl3 C A 5: 81,477,729 (GRCm39) H61N probably benign Het
Adgrl4 C A 3: 151,205,812 (GRCm39) P175T probably benign Het
Adgrv1 G A 13: 81,624,791 (GRCm39) P3726L probably damaging Het
Adra1a T G 14: 66,964,945 (GRCm39) F312V probably damaging Het
Adrm1b A G 3: 92,336,397 (GRCm39) S102P probably damaging Het
Aebp1 C T 11: 5,821,460 (GRCm39) R620* probably null Het
Afdn G A 17: 14,104,042 (GRCm39) S1126N probably damaging Het
Afg3l1 A C 8: 124,214,981 (GRCm39) E216D possibly damaging Het
Afp G C 5: 90,652,874 (GRCm39) G448A possibly damaging Het
Agap2 G T 10: 126,924,111 (GRCm39) S775I unknown Het
Agbl1 T G 7: 76,069,652 (GRCm39) F143V probably benign Het
Ahnak A T 19: 8,993,446 (GRCm39) N4910I probably damaging Het
Ak1 A T 2: 32,520,283 (GRCm39) K27M probably damaging Het
Aldh1b1 C T 4: 45,802,540 (GRCm39) A26V probably benign Het
Aldh1b1 G C 4: 45,802,539 (GRCm39) A26P probably benign Het
Alk C G 17: 72,512,802 (GRCm39) G386R probably damaging Het
Amn C T 12: 111,242,117 (GRCm39) A368V probably benign Het
Amotl2 TCC TC 9: 102,600,897 (GRCm39) probably null Het
Ampd3 T G 7: 110,377,032 (GRCm39) L8V probably damaging Het
Anapc2 G T 2: 25,163,380 (GRCm39) G206* probably null Het
Angel2 G A 1: 190,669,751 (GRCm39) D144N probably damaging Het
Angptl3 A G 4: 98,922,757 (GRCm39) N266S probably benign Het
Ank2 A G 3: 126,823,158 (GRCm39) V397A possibly damaging Het
Ankib1 C A 5: 3,763,137 (GRCm39) E531* probably null Het
Ankib1 T A 5: 3,763,136 (GRCm39) E531V probably damaging Het
Ankrd16 CCTCCGGTACTT C 2: 11,784,629 (GRCm39) probably null Het
Ankrd24 G A 10: 81,474,490 (GRCm39) G74D probably damaging Het
Ankrd44 A C 1: 54,698,141 (GRCm39) L606R probably damaging Het
Ankrd50 T G 3: 38,511,314 (GRCm39) K351T probably damaging Het
Anks4b G A 7: 119,781,742 (GRCm39) D258N probably benign Het
Anln T C 9: 22,274,097 (GRCm39) E580G probably benign Het
Ano3 G A 2: 110,576,192 (GRCm39) L454F probably damaging Het
Antxrl A T 14: 33,789,928 (GRCm39) N340I probably damaging Het
Anxa10 C T 8: 62,545,540 (GRCm39) G64D probably damaging Het
Aox1 G A 1: 58,120,701 (GRCm39) V865M probably benign Het
Ap3d1 T C 10: 80,555,071 (GRCm39) Y418C possibly damaging Het
Ap5b1 A C 19: 5,620,452 (GRCm39) K624T possibly damaging Het
Apbb1 C T 7: 105,208,343 (GRCm39) C654Y probably damaging Het
Apbb2 T G 5: 66,460,039 (GRCm39) K710T probably damaging Het
Apc C T 18: 34,446,220 (GRCm39) Q1021* probably null Het
Apcdd1 T G 18: 63,070,254 (GRCm39) F174V probably benign Het
Apob A T 12: 8,055,945 (GRCm39) K1476* probably null Het
Apob C A 12: 8,055,074 (GRCm39) L1358I possibly damaging Het
Apob A G 12: 8,062,936 (GRCm39) N193S possibly damaging Het
Apobr G A 7: 126,184,203 (GRCm39) R7H probably benign Het
Apol11b A C 15: 77,522,207 (GRCm39) I30R probably benign Het
Arfgef2 A T 2: 166,735,515 (GRCm39) T1727S possibly damaging Het
Arfip2 G C 7: 105,286,449 (GRCm39) L188V probably damaging Het
Arhgap11a A G 2: 113,673,239 (GRCm39) C115R probably damaging Het
Arhgap18 A T 10: 26,726,000 (GRCm39) probably null Het
Arhgap26 G C 18: 39,490,724 (GRCm39) probably benign Het
Arhgap28 G A 17: 68,168,272 (GRCm39) A465V possibly damaging Het
Arhgdib C A 6: 136,910,616 (GRCm39) K48N probably damaging Het
Arhgef10 C G 8: 15,014,191 (GRCm39) A364G probably benign Het
Arhgef10l G C 4: 140,309,046 (GRCm39) L17V possibly damaging Het
Arhgef18 C T 8: 3,489,628 (GRCm39) S320F probably damaging Het
Arhgef28 G A 13: 98,082,199 (GRCm39) R1203W probably damaging Het
Arl5b G A 2: 15,079,832 (GRCm39) M134I probably benign Het
Armc1 C A 3: 19,203,671 (GRCm39) S85I probably damaging Het
Armc12 A G 17: 28,751,033 (GRCm39) E83G probably benign Het
Armh1 C T 4: 117,070,992 (GRCm39) D378N probably benign Het
Armh3 T C 19: 45,807,344 (GRCm39) E684G probably damaging Het
Arsj G T 3: 126,232,781 (GRCm39) R509M possibly damaging Het
Arvcf G A 16: 18,221,391 (GRCm39) R602H probably damaging Het
Asb14 A G 14: 26,625,305 (GRCm39) K220R probably benign Het
Ascc2 C G 11: 4,596,656 (GRCm39) A59G probably benign Het
Asf1b G C 8: 84,695,781 (GRCm39) A141P possibly damaging Het
Ash1l C A 3: 88,890,016 (GRCm39) L632I probably benign Het
Asph T A 4: 9,630,715 (GRCm39) N211I possibly damaging Het
Astn1 C A 1: 158,300,067 (GRCm39) P136T possibly damaging Het
Astn1 C A 1: 158,511,666 (GRCm39) Y1169* probably null Het
Astn1 G A 1: 158,424,776 (GRCm39) R646H possibly damaging Het
Asxl3 A C 18: 22,649,829 (GRCm39) K606T probably benign Het
Atf7 C G 15: 102,455,617 (GRCm39) G249A probably benign Het
Atg14 C G 14: 47,805,749 (GRCm39) A39P probably damaging Het
Atg7 T A 6: 114,672,647 (GRCm39) F205I probably benign Het
Atm T G 9: 53,442,987 (GRCm39) K92T probably damaging Het
Atp11b G T 3: 35,866,362 (GRCm39) G387V probably damaging Het
Atp12a G A 14: 56,623,598 (GRCm39) V879I probably benign Het
Atp13a5 T G 16: 29,100,880 (GRCm39) K681N probably benign Het
Atp2b2 A C 6: 113,819,267 (GRCm39) F9V probably damaging Het
Atp6v1h A C 1: 5,168,271 (GRCm39) K147T probably damaging Het
Atp8a2 T G 14: 60,265,419 (GRCm39) S306R probably benign Het
Atp8b2 T C 3: 89,861,875 (GRCm39) K226R probably damaging Het
Atr A G 9: 95,767,373 (GRCm39) probably null Het
Atrn G A 2: 130,815,319 (GRCm39) S745N probably benign Het
Auts2 T G 5: 131,505,392 (GRCm39) probably benign Het
Avpr1a G C 10: 122,285,482 (GRCm39) S258T probably benign Het
AW551984 C A 9: 39,501,899 (GRCm39) E736* probably null Het
B3galt6 C A 4: 156,076,391 (GRCm39) R228L probably benign Het
B3gnt3 G A 8: 72,146,409 (GRCm39) S40F possibly damaging Het
B3gnt8 C T 7: 25,327,575 (GRCm39) R2C probably damaging Het
Barx2 G A 9: 31,758,162 (GRCm39) P259S possibly damaging Het
Baz2b T A 2: 59,790,359 (GRCm39) E618V probably damaging Het
BC016579 C T 16: 45,474,311 (GRCm39) D32N probably benign Het
BC051665 T G 13: 60,932,457 (GRCm39) E76A probably benign Het
Bcl9 G T 3: 97,117,957 (GRCm39) Q246K possibly damaging Het
Best3 C T 10: 116,860,075 (GRCm39) S445L probably benign Het
Bfar C T 16: 13,515,324 (GRCm39) P304L probably damaging Het
Birc6 A C 17: 74,918,537 (GRCm39) E1932D probably damaging Het
Bltp1 A C 3: 37,041,716 (GRCm39) E2698A probably damaging Het
Bod1l C T 5: 41,978,489 (GRCm39) E942K probably damaging Het
Bod1l C G 5: 41,966,107 (GRCm39) V2653L possibly damaging Het
Bptf A C 11: 106,965,408 (GRCm39) V1147G probably benign Het
Braf A G 6: 39,638,960 (GRCm39) C264R probably damaging Het
Brca2 A T 5: 150,466,228 (GRCm39) K1997N probably damaging Het
Brf2 T G 8: 27,614,019 (GRCm39) E389A probably damaging Het
Brinp2 G A 1: 158,074,559 (GRCm39) R521* probably null Het
Brsk1 C T 7: 4,710,371 (GRCm39) T460M possibly damaging Het
Brwd3 A T X: 107,818,466 (GRCm39) V732E probably damaging Het
Btaf1 T A 19: 36,964,018 (GRCm39) V863D probably damaging Het
C1rl C A 6: 124,485,701 (GRCm39) D357E probably benign Het
Cacna1b T A 2: 24,551,856 (GRCm39) K1096M probably damaging Het
Cacna1b T A 2: 24,623,957 (GRCm39) S208C probably damaging Het
Cacna1f C G X: 7,476,490 (GRCm39) L144V probably damaging Het
Cacna2d1 A C 5: 16,399,761 (GRCm39) E121D probably benign Het
Cacna2d3 G T 14: 28,786,265 (GRCm39) A574D probably damaging Het
Cadps C A 14: 12,467,113 (GRCm38) D935Y probably damaging Het
Camk2a T G 18: 61,076,222 (GRCm39) probably benign Het
Capn15 C T 17: 26,182,321 (GRCm39) E530K probably damaging Het
Carmil1 G A 13: 24,228,165 (GRCm39) Q600* probably null Het
Carmil3 C T 14: 55,739,025 (GRCm39) T893M probably damaging Het
Casp12 C T 9: 5,354,582 (GRCm39) A317V possibly damaging Het
Casp9 T G 4: 141,532,772 (GRCm39) L223V probably benign Het
Casz1 T C 4: 149,028,816 (GRCm39) L1087P probably benign Het
Catsper3 T G 13: 55,955,917 (GRCm39) F328V probably damaging Het
Cavin1 T C 11: 100,849,484 (GRCm39) D382G probably damaging Het
Ccdc116 C A 16: 16,965,035 (GRCm39) probably benign Het
Ccdc14 G A 16: 34,511,174 (GRCm39) M1I probably null Het
Ccdc141 T G 2: 76,958,616 (GRCm39) E161D probably benign Het
Ccdc175 G T 12: 72,175,153 (GRCm39) H507N probably benign Het
Ccdc24 C T 4: 117,728,260 (GRCm39) probably null Het
Ccdc83 T C 7: 89,893,254 (GRCm39) K168E probably damaging Het
Ccdc87 A G 19: 4,890,750 (GRCm39) K414R probably benign Het
Ccr1l1 T G 9: 123,777,887 (GRCm39) I187L probably benign Het
Cd209a G T 8: 3,797,017 (GRCm39) S80Y probably damaging Het
Cd2ap G A 17: 43,118,884 (GRCm39) T518I probably benign Het
Cd300lb A C 11: 114,816,860 (GRCm39) L61V probably damaging Het
Cd36 T A 5: 18,000,573 (GRCm39) probably null Het
Cd40 A T 2: 164,904,960 (GRCm39) K92M probably damaging Het
Cd48 A T 1: 171,523,295 (GRCm39) D46V possibly damaging Het
Cd55 T G 1: 130,380,216 (GRCm39) D254A probably benign Het
Cd59b G C 2: 103,911,348 (GRCm39) S23T possibly damaging Het
Cd8a T C 6: 71,350,670 (GRCm39) L45P possibly damaging Het
Cd93 T A 2: 148,284,284 (GRCm39) D354V probably benign Het
Cd99l2 G T X: 70,484,694 (GRCm39) P63Q probably damaging Het
Cd99l2 C T X: 70,484,752 (GRCm39) probably null Het
Cdan1 T C 2: 120,560,817 (GRCm39) S251G probably damaging Het
Cdca2 G C 14: 67,937,747 (GRCm39) T302S probably benign Het
Cdca7l A G 12: 117,836,146 (GRCm39) M206V possibly damaging Het
Cdcp3 T C 7: 130,848,362 (GRCm39) C839R probably damaging Het
Cdh20 C G 1: 110,012,853 (GRCm39) I395M probably benign Het
Cdh22 T C 2: 164,954,350 (GRCm39) S724G probably benign Het
Cdh23 T C 10: 60,249,423 (GRCm39) T832A probably benign Het
Cdh8 G T 8: 100,006,134 (GRCm39) S151Y probably damaging Het
Cdk11b G T 4: 155,726,021 (GRCm39) probably benign Het
Cdkal1 G C 13: 29,961,219 (GRCm39) H117D probably damaging Het
Cdr1 T G X: 60,227,710 (GRCm39) E485D possibly damaging Het
Celf4 G C 18: 25,629,306 (GRCm39) P406A probably benign Het
Celf5 C T 10: 81,302,783 (GRCm39) A301T probably damaging Het
Celsr2 T A 3: 108,321,433 (GRCm39) S460C probably damaging Het
Cenpf A C 1: 189,385,128 (GRCm39) L2384R probably damaging Het
Cenpp T C 13: 49,801,134 (GRCm39) probably null Het
Ces1a T G 8: 93,752,235 (GRCm39) K374T probably benign Het
Ces1b T C 8: 93,791,594 (GRCm39) E335G probably damaging Het
Ces1d T C 8: 93,901,736 (GRCm39) K411R probably benign Het
Ces1e T C 8: 93,937,046 (GRCm39) T342A probably benign Het
Ces2e A C 8: 105,657,979 (GRCm39) K359T probably benign Het
Ces2e A G 8: 105,659,030 (GRCm39) probably null Het
Cfap44 G T 16: 44,221,829 (GRCm39) R14I probably damaging Het
Cfap46 C T 7: 139,214,980 (GRCm39) G1582R probably damaging Het
Cfap47 C A X: 78,374,419 (GRCm39) L2544F probably damaging Het
Cfap47 A T X: 78,374,420 (GRCm39) L2544* probably null Het
Cfap57 C T 4: 118,439,079 (GRCm39) D816N probably benign Het
Cfap61 C T 2: 145,971,147 (GRCm39) P919L probably benign Het
Cfh A G 1: 140,036,642 (GRCm39) L636P probably benign Het
Cfh G A 1: 140,075,456 (GRCm39) P243S possibly damaging Het
Cfhr4 T A 1: 139,681,999 (GRCm39) Q199L probably damaging Het
Chd6 T C 2: 160,808,408 (GRCm39) D1602G probably damaging Het
Chi3l1 A G 1: 134,117,238 (GRCm39) K345R probably benign Het
Chrd T C 16: 20,560,005 (GRCm39) F891L probably damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cilp2 C G 8: 70,338,060 (GRCm39) K190N possibly damaging Het
Cit A T 5: 116,123,592 (GRCm39) S1421C possibly damaging Het
Clca3a1 T G 3: 144,452,714 (GRCm39) S590R probably damaging Het
Clcn1 C A 6: 42,277,294 (GRCm39) L462I probably benign Het
Clcn1 A C 6: 42,284,190 (GRCm39) K514T probably damaging Het
Cldn4 G A 5: 134,975,452 (GRCm39) L50F probably damaging Het
Clec4g T G 8: 3,766,548 (GRCm39) N251T probably damaging Het
Clec4g A C 8: 3,757,796 (GRCm39) probably benign Het
Clu A C 14: 66,214,362 (GRCm39) E278D probably benign Het
Cmya5 C G 13: 93,200,087 (GRCm39) A3414P probably benign Het
CN725425 T G 15: 91,129,965 (GRCm39) F276C possibly damaging Het
Cnksr2 T G X: 156,636,216 (GRCm39) N854T probably benign Het
Cnot7 ATTTATTTTTTA ATTTA 8: 40,953,780 (GRCm39) probably benign Het
Cnst G C 1: 179,407,130 (GRCm39) G59A probably damaging Het
Cntn3 A G 6: 102,397,255 (GRCm39) L106P possibly damaging Het
Cntnap4 C G 8: 113,542,152 (GRCm39) P762A probably damaging Het
Cntnap5a G A 1: 115,987,981 (GRCm39) A171T probably benign Het
Col17a1 A G 19: 47,640,617 (GRCm39) S994P possibly damaging Het
Col19a1 A C 1: 24,319,021 (GRCm39) I1023S probably damaging Het
Col4a1 T G 8: 11,296,859 (GRCm39) probably benign Het
Col4a4 A C 1: 82,430,917 (GRCm39) L1662V unknown Het
Col6a1 C G 10: 76,545,393 (GRCm39) *1026Y probably null Het
Col6a5 A C 9: 105,803,266 (GRCm39) I1233S unknown Het
Col7a1 C T 9: 108,807,568 (GRCm39) silent Het
Colec12 A G 18: 9,848,727 (GRCm39) T302A probably benign Het
Commd4 T C 9: 57,063,540 (GRCm39) S73G probably benign Het
Coro1c A G 5: 113,988,710 (GRCm39) probably null Het
Cpd C A 11: 76,692,572 (GRCm39) C755F probably damaging Het
Cpsf6 T C 10: 117,191,946 (GRCm39) D518G unknown Het
Creb3l4 C T 3: 90,145,058 (GRCm39) V365M possibly damaging Het
Crhr2 A G 6: 55,080,201 (GRCm39) V126A possibly damaging Het
Crim1 G T 17: 78,675,264 (GRCm39) K824N probably benign Het
Crispld1 A G 1: 17,834,300 (GRCm39) T489A probably benign Het
Crybg1 C T 10: 43,873,307 (GRCm39) R1267H probably benign Het
Cryzl2 G T 1: 157,293,359 (GRCm39) L153F probably benign Het
Csgalnact1 T C 8: 68,853,982 (GRCm39) K273R probably damaging Het
Csmd1 T G 8: 16,239,992 (GRCm39) K1140T possibly damaging Het
Csmd1 G T 8: 16,250,072 (GRCm39) Q969K probably damaging Het
Csmd1 T C 8: 16,396,631 (GRCm39) D433G probably damaging Het
Csmd1 C T 8: 16,142,272 (GRCm39) D1544N probably damaging Het
Csmd1 G T 8: 15,971,875 (GRCm39) T2985N possibly damaging Het
Csmd3 G A 15: 47,499,789 (GRCm39) L3027F probably damaging Het
Csmd3 G A 15: 47,710,677 (GRCm39) P1637S probably damaging Het
Csn2 T G 5: 87,843,868 (GRCm39) probably benign Het
Cspg4 C A 9: 56,793,320 (GRCm39) L352M probably damaging Het
Cspp1 C G 1: 10,153,771 (GRCm39) D393E possibly damaging Het
Ctcfl G A 2: 172,960,137 (GRCm39) H149Y probably benign Het
Ctnna3 C T 10: 63,417,757 (GRCm39) S165F probably benign Het
Ctnnd2 A C 15: 30,966,959 (GRCm39) N970T probably benign Het
Ctr9 T C 7: 110,629,431 (GRCm39) L19P probably damaging Het
Ctsd C T 7: 141,930,334 (GRCm39) G403S probably damaging Het
Cubn G A 2: 13,299,040 (GRCm39) S3211L probably benign Het
Cul3 A G 1: 80,267,808 (GRCm39) V177A probably benign Het
Cxcl16 C T 11: 70,346,804 (GRCm39) G113E probably damaging Het
Cyfip1 A C 7: 55,524,800 (GRCm39) K144T probably damaging Het
Cyp2a12 A G 7: 26,734,845 (GRCm39) K422R possibly damaging Het
Cyp2a5 G T 7: 26,540,532 (GRCm39) D69Y probably damaging Het
Cyp2b23 C G 7: 26,380,836 (GRCm39) A130P probably benign Het
Cyp2c50 C T 19: 40,086,399 (GRCm39) A321V possibly damaging Homo
Cyp2c68 C T 19: 39,727,907 (GRCm39) A82T probably damaging Het
Cyp2d11 C A 15: 82,274,312 (GRCm39) M356I probably damaging Het
Cyp2r1 C T 7: 114,151,209 (GRCm39) R370K probably damaging Het
Cyp2t4 G C 7: 26,857,171 (GRCm39) G345R probably damaging Het
Cyp3a59 A C 5: 146,035,032 (GRCm39) N237H probably benign Het
Cyp4a29 T G 4: 115,105,693 (GRCm39) F132V probably benign Het
Cyp4f15 G C 17: 32,911,664 (GRCm39) probably null Het
Cyp4f40 G A 17: 32,892,976 (GRCm39) probably null Het
D030056L22Rik A T 19: 18,694,679 (GRCm39) S145C possibly damaging Het
D7Ertd443e T G 7: 133,896,711 (GRCm39) S154R probably benign Het
Dab1 A C 4: 104,336,429 (GRCm39) Q8H probably damaging Het
Dag1 G C 9: 108,085,867 (GRCm39) P425A possibly damaging Het
Dapk2 T C 9: 66,153,759 (GRCm39) F172L possibly damaging Het
Daw1 A T 1: 83,183,685 (GRCm39) K245M probably null Het
Dbnl A T 11: 5,746,797 (GRCm39) K176* probably null Het
Dcaf13 C T 15: 39,008,642 (GRCm39) R415C probably damaging Het
Dcaf15 A C 8: 84,829,410 (GRCm39) W111G probably damaging Het
Dcaf8l A G X: 88,449,943 (GRCm39) V62A probably benign Het
Dclk1 G T 3: 55,407,526 (GRCm39) G235V probably damaging Het
Dclre1c G T 2: 3,439,117 (GRCm39) E92D possibly damaging Het
Dda1 C G 8: 71,927,139 (GRCm39) A4G probably damaging Het
Ddb1 C A 19: 10,596,594 (GRCm39) L438I probably damaging Het
Ddit4l G C 3: 137,332,123 (GRCm39) G163A probably benign Het
Ddn T C 15: 98,704,020 (GRCm39) E424G possibly damaging Het
Ddx19b T G 8: 111,742,207 (GRCm39) K176T probably benign Het
Ddx23 A G 15: 98,545,502 (GRCm39) V602A probably benign Het
Ddx59 A C 1: 136,360,189 (GRCm39) N401T possibly damaging Het
Def8 A G 8: 124,183,237 (GRCm39) R279G probably damaging Het
Defb14 G T 8: 19,245,200 (GRCm39) G59V probably damaging Het
Defb8 A C 8: 19,497,557 (GRCm39) L18R possibly damaging Het
Defb9 A C 8: 22,371,883 (GRCm39) F43L probably benign Het
Dennd1a A G 2: 37,690,704 (GRCm39) S799P probably benign Het
Dennd2d C T 3: 106,407,190 (GRCm39) R414* probably null Het
Dennd4a G A 9: 64,779,304 (GRCm39) A596T probably damaging Het
Dennd5a T G 7: 109,493,954 (GRCm39) D1250A possibly damaging Het
Dennd5a T C 7: 109,504,480 (GRCm39) K854E probably damaging Het
Dera T G 6: 137,814,116 (GRCm39) I99M possibly damaging Het
Desi2 A G 1: 178,015,510 (GRCm39) N10S probably benign Het
Dgkg T G 16: 22,288,078 (GRCm39) N763T probably damaging Het
Dgkg A T 16: 22,391,436 (GRCm39) S341T probably benign Het
Dhh T C 15: 98,792,790 (GRCm39) N157D probably benign Het
Dhtkd1 C A 2: 5,916,685 (GRCm39) A664S possibly damaging Het
Dhx37 T C 5: 125,493,655 (GRCm39) E968G possibly damaging Het
Dhx57 A C 17: 80,558,777 (GRCm39) L1061V probably damaging Het
Dip2a T C 10: 76,121,462 (GRCm39) K798R probably benign Het
Disp3 G C 4: 148,356,200 (GRCm39) A220G possibly damaging Het
Dlg4 G A 11: 69,921,956 (GRCm39) R66Q probably damaging Het
Dlg5 G A 14: 24,208,162 (GRCm39) P992S probably damaging Het
Dlgap2 C G 8: 14,872,472 (GRCm39) A651G probably benign Het
Dlx5 C A 6: 6,879,607 (GRCm39) Q153H probably damaging Het
Dmd A G X: 83,619,366 (GRCm39) T2614A probably benign Het
Dmd C T X: 82,922,101 (GRCm39) S1457F possibly damaging Het
Dmrt2 T G 19: 25,656,006 (GRCm39) L535R probably damaging Het
Dmxl1 A G 18: 50,054,032 (GRCm39) N2546S probably benign Het
Dnaaf3 G A 7: 4,526,794 (GRCm39) R428W probably damaging Het
Dnah1 T G 14: 31,026,768 (GRCm39) K752T probably benign Het
Dnah11 C A 12: 117,946,704 (GRCm39) A3127S probably damaging Het
Dnah11 G C 12: 117,858,747 (GRCm39) T4121R probably damaging Het
Dnah2 A C 11: 69,321,619 (GRCm39) L3847R probably damaging Het
Dnah3 T A 7: 119,685,520 (GRCm39) D164V probably benign Het
Dnah3 T C 7: 119,610,096 (GRCm39) K1769R probably null Het
Dnah5 G A 15: 28,366,503 (GRCm39) G2739S probably null Het
Dnah5 A C 15: 28,384,376 (GRCm39) D3040A probably damaging Het
Dnah7a A C 1: 53,507,802 (GRCm39) Y3090D probably damaging Het
Dnajb12 C A 10: 59,725,876 (GRCm39) P54T probably benign Het
Dnajb8 G A 6: 88,199,827 (GRCm39) G121D probably benign Het
Dnajc6 G A 4: 101,496,526 (GRCm39) V830M probably damaging Het
Dnhd1 C G 7: 105,361,934 (GRCm39) T3664S probably benign Het
Dnmbp G A 19: 43,863,423 (GRCm39) A453V probably benign Het
Dnmbp G A 19: 43,890,561 (GRCm39) P402L probably benign Het
Dock1 A G 7: 134,406,276 (GRCm39) Y760C probably damaging Het
Dock10 T C 1: 80,510,064 (GRCm39) K1588R probably damaging Het
Dock11 A G X: 35,266,186 (GRCm39) K718R probably benign Het
Dock2 C A 11: 34,586,039 (GRCm39) E548* probably null Het
Dock2 A C 11: 34,583,209 (GRCm39) L568R probably damaging Het
Dock2 G A 11: 34,388,300 (GRCm39) T211M probably benign Het
Dock9 C T 14: 121,792,687 (GRCm39) V1844M probably damaging Het
Dop1b C T 16: 93,560,214 (GRCm39) T720I probably benign Het
Dpf2 A C 19: 5,952,472 (GRCm39) F289V probably damaging Het
Dpy19l2 C T 9: 24,572,120 (GRCm39) probably null Het
Dsc2 C T 18: 20,179,361 (GRCm39) E236K probably damaging Het
Dscam A C 16: 96,573,761 (GRCm39) F734V probably benign Het
Dscc1 A C 15: 54,943,713 (GRCm39) S386A possibly damaging Het
Duxf4 T G 10: 58,071,733 (GRCm39) E160D probably damaging Het
Dync1h1 GAAA GAA 12: 110,596,351 (GRCm39) probably null Het
Dyrk3 A G 1: 131,056,970 (GRCm39) L401P probably damaging Het
Ecm1 T C 3: 95,642,188 (GRCm39) I466V probably benign Het
Eef2 G C 10: 81,017,723 (GRCm39) G795A probably damaging Het
Efcab3 A C 11: 104,642,728 (GRCm39) K1117T probably damaging Het
Efcab6 A C 15: 83,839,210 (GRCm39) L383R probably damaging Het
Efl1 A C 7: 82,342,058 (GRCm39) S489R probably benign Het
Egfl8 C A 17: 34,833,215 (GRCm39) G177V probably damaging Het
Ehbp1l1 G C 19: 5,766,315 (GRCm39) P399A possibly damaging Het
Ehd2 G C 7: 15,697,391 (GRCm39) A139G possibly damaging Het
Eif1ad3 A C 12: 87,843,704 (GRCm39) E117A possibly damaging Het
Eif3j1 T G 2: 121,881,094 (GRCm39) F182C probably damaging Het
Eif3k T C 7: 28,674,024 (GRCm39) probably null Het
Eif3m A C 2: 104,843,601 (GRCm39) L127R probably damaging Het
Elac1 T G 18: 73,872,161 (GRCm39) D278A probably benign Het
Ell2 TCTAGGTGGCC TC 13: 75,909,992 (GRCm39) probably benign Het
Elmod1 A C 9: 53,826,898 (GRCm39) S263A probably benign Het
Eme2 T A 17: 25,113,541 (GRCm39) probably null Het
Eml1 T G 12: 108,503,718 (GRCm39) F772V possibly damaging Het
Emsy G A 7: 98,249,929 (GRCm39) P786L probably damaging Het
Epb41l3 T G 17: 69,560,517 (GRCm39) F355V probably damaging Het
Epg5 C G 18: 78,002,354 (GRCm39) A591G probably benign Het
Epha4 A C 1: 77,483,299 (GRCm39) S237A possibly damaging Het
Epha5 G C 5: 84,385,381 (GRCm39) H317D probably benign Het
Ephb1 C T 9: 101,861,344 (GRCm39) V607I probably damaging Het
Ephx2 A G 14: 66,344,767 (GRCm39) F168L probably benign Het
Eps15l1 T G 8: 73,140,745 (GRCm39) N249T probably damaging Het
Ercc6l2 A G 13: 64,001,542 (GRCm39) E567G possibly damaging Het
Ermp1 G C 19: 29,590,325 (GRCm39) S792R probably damaging Het
Esp8 A G 17: 40,840,936 (GRCm39) T66A possibly damaging Het
Esr1 C G 10: 4,662,667 (GRCm39) A95G possibly damaging Het
Esrrg A T 1: 187,882,415 (GRCm39) E224V probably benign Het
Etaa1 T C 11: 17,896,465 (GRCm39) T551A possibly damaging Het
Etv5 C T 16: 22,202,339 (GRCm39) E472K probably benign Het
Exoc3l4 G A 12: 111,395,921 (GRCm39) D645N probably benign Het
Eya4 T C 10: 22,989,887 (GRCm39) Q513R probably damaging Het
F11 C T 8: 45,698,809 (GRCm39) G445D possibly damaging Het
F13a1 C T 13: 37,172,986 (GRCm39) W131* probably null Het
F13b A C 1: 139,435,940 (GRCm39) S249R probably benign Het
F5 A C 1: 163,981,954 (GRCm39) K73T probably benign Het
F8 C T X: 74,366,755 (GRCm39) probably null Het
Fads2b T G 2: 85,314,525 (GRCm39) K476T probably damaging Het
Fads2b C A 2: 85,332,421 (GRCm39) S201I probably benign Het
Fam117a C G 11: 95,262,350 (GRCm39) H151Q possibly damaging Het
Fam186a T C 15: 99,843,875 (GRCm39) S790G unknown Het
Fam193a A T 5: 34,578,239 (GRCm39) E244D probably benign Het
Fancd2 C G 6: 113,558,383 (GRCm39) H1167D probably benign Het
Far2 A C 6: 148,040,156 (GRCm39) K29T probably damaging Het
Fat1 A G 8: 45,476,844 (GRCm39) I1963M possibly damaging Het
Fat4 C G 3: 39,012,641 (GRCm39) A2312G probably benign Het
Fat4 C G 3: 38,941,199 (GRCm39) L31V possibly damaging Het
Fbln2 G A 6: 91,210,328 (GRCm39) D91N probably damaging Het
Fbn1 C T 2: 125,192,208 (GRCm39) D1434N probably damaging Het
Fbxo16 A T 14: 65,531,309 (GRCm39) K71M possibly damaging Het
Fbxw21 T C 9: 108,974,605 (GRCm39) H305R probably benign Het
Fem1al C G 11: 29,775,007 (GRCm39) G150A probably damaging Het
Fgd4 T A 16: 16,302,334 (GRCm39) K74* probably null Het
Fgfr2 A T 7: 129,771,529 (GRCm39) L596H probably damaging Het
Fhl1 T A X: 55,824,851 (GRCm39) L10Q probably null Het
Fig4 A C 10: 41,129,727 (GRCm39) F498V probably damaging Het
Fign A C 2: 63,927,246 (GRCm39) S6R probably benign Het
Filip1l G C 16: 57,333,768 (GRCm39) S187T probably damaging Het
Fitm2 C T 2: 163,311,785 (GRCm39) E143K probably benign Het
Flnb A C 14: 7,905,871 (GRCm38) K1207T probably benign Het
Flnc G A 6: 29,457,150 (GRCm39) A2351T probably damaging Het
Flt1 T C 5: 147,618,459 (GRCm39) T261A possibly damaging Het
Flt3 C G 5: 147,286,374 (GRCm39) probably null Het
Fmn1 A C 2: 113,272,270 (GRCm39) probably benign Het
Fmo9 A G 1: 166,501,114 (GRCm39) probably null Het
Fn1 A G 1: 71,688,451 (GRCm39) I151T probably damaging Het
Fndc1 T G 17: 8,001,311 (GRCm39) E139A probably damaging Het
Fndc3b G C 3: 27,519,957 (GRCm39) C561W possibly damaging Het
Fndc7 T C 3: 108,790,816 (GRCm39) E70G probably damaging Het
Folh1 T G 7: 86,375,162 (GRCm39) K575T probably benign Het
Foxc2 G C 8: 121,843,698 (GRCm39) W115C possibly damaging Het
Foxc2 G C 8: 121,843,889 (GRCm39) R179P probably damaging Het
Foxl1 G A 8: 121,855,511 (GRCm39) E271K possibly damaging Het
Foxred2 C T 15: 77,836,203 (GRCm39) A385T probably damaging Het
Fpr-rs4 T C 17: 18,242,181 (GRCm39) S63P possibly damaging Het
Fpr-rs4 G A 17: 18,242,956 (GRCm39) R321K probably benign Het
Fras1 T C 5: 96,906,001 (GRCm39) L3135P probably benign Het
Fras1 A C 5: 96,891,070 (GRCm39) Q2866H probably damaging Het
Frem1 C T 4: 82,890,504 (GRCm39) E974K probably damaging Het
Frem3 A C 8: 81,342,055 (GRCm39) Q1449H probably benign Het
Frmd6 A G 12: 70,927,452 (GRCm39) Q144R probably benign Het
Frmd7 T G X: 49,985,024 (GRCm39) N382T possibly damaging Het
Frmpd1 C T 4: 45,284,080 (GRCm39) P967L possibly damaging Het
Frmpd4 G A X: 166,280,836 (GRCm39) T348M probably damaging Het
Fryl A C 5: 73,248,081 (GRCm39) L1012R probably damaging Het
Fryl A C 5: 73,248,052 (GRCm39) L1022V probably damaging Het
Fsd1 T A 17: 56,298,203 (GRCm39) L176H probably damaging Het
Fsip2 A C 2: 82,817,997 (GRCm39) S4577R possibly damaging Het
Fsip2 A C 2: 82,818,978 (GRCm39) K4904Q possibly damaging Het
Fsip2 G C 2: 82,805,792 (GRCm39) E704Q probably damaging Het
Fyb1 G A 15: 6,688,021 (GRCm39) V794I probably benign Het
Fzd10 T C 5: 128,678,310 (GRCm39) L10P probably damaging Het
Fzd7 G C 1: 59,523,029 (GRCm39) G304A probably damaging Het
Gadl1 A T 9: 115,766,338 (GRCm39) I37L probably benign Het
Gal3st1 C G 11: 3,947,984 (GRCm39) P64A probably benign Het
Gal3st2c A G 1: 93,935,867 (GRCm39) H73R probably benign Het
Galnt10 G A 11: 57,612,157 (GRCm39) G66R possibly damaging Het
Garin3 G A 11: 46,298,550 (GRCm39) R618K possibly damaging Het
Gbp2 G A 3: 142,335,776 (GRCm39) D159N probably benign Het
Gbp4 A T 5: 105,268,863 (GRCm39) F430Y probably damaging Het
Gbp9 C A 5: 105,241,991 (GRCm39) G189W probably damaging Het
Gclc G A 9: 77,688,649 (GRCm39) probably null Het
Gcm2 C A 13: 41,256,268 (GRCm39) G494W probably damaging Het
Gcnt2 C A 13: 41,072,115 (GRCm39) P253T probably damaging Het
Gdf10 C T 14: 33,654,347 (GRCm39) R285C probably damaging Het
Gdpd4 A G 7: 97,615,516 (GRCm39) S114G probably damaging Het
Gga1 C A 15: 78,776,221 (GRCm39) D421E probably damaging Het
Ggt5 T G 10: 75,444,593 (GRCm39) F304V possibly damaging Het
Gja3 A C 14: 57,273,272 (GRCm39) L367V possibly damaging Het
Gje1 A C 10: 14,593,868 (GRCm39) F9V possibly damaging Het
Glrb T G 3: 80,752,541 (GRCm39) K407N possibly damaging Het
Glyat A G 19: 12,625,373 (GRCm39) T32A probably benign Het
Gm10784 T G 13: 50,099,179 (GRCm39) noncoding transcript Het
Gm1110 A C 9: 26,824,606 (GRCm39) L145V probably benign Het
Gm11559 C A 11: 99,755,775 (GRCm39) C141* probably null Het
Gm13741 A T 2: 87,486,765 (GRCm39) S167T probably damaging Het
Gm13741 A C 2: 87,487,221 (GRCm39) L15V probably benign Het
Gm15127 A G X: 147,478,492 (GRCm39) T415A probably benign Het
Gm15932 G C 14: 55,813,297 (GRCm39) probably benign Het
Gm1818 C A 12: 48,602,907 (GRCm39) noncoding transcript Het
Gm19965 T G 1: 116,732,330 (GRCm39) F58V probably benign Het
Gm20939 T C 17: 95,184,861 (GRCm39) F503S probably damaging Het
Gm21834 T G 17: 58,049,116 (GRCm39) E33D possibly damaging Het
Gm266 C G 12: 111,451,606 (GRCm39) G200A probably damaging Het
Gm266 T C 12: 111,451,771 (GRCm39) E145G probably damaging Het
Gm4775 C G 14: 106,338,399 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,300 (GRCm39) N90D possibly damaging Het
Gm5114 T C 7: 39,057,871 (GRCm39) K583E probably damaging Het
Gm5565 G A 5: 146,095,479 (GRCm39) T172I probably benign Het
Gm8267 T C 14: 44,962,322 (GRCm39) K33E probably benign Het
Gm8674 T C 13: 50,055,284 (GRCm39) noncoding transcript Het
Gm8674 C A 13: 50,054,830 (GRCm39) noncoding transcript Het
Gm904 A C 13: 50,799,298 (GRCm39) K86Q probably damaging Het
Gm9637 A G 14: 19,401,731 (GRCm38) noncoding transcript Het
Gm9758 C G 5: 14,963,553 (GRCm39) V92L probably benign Het
Gm9805 A G 17: 22,689,871 (GRCm38) Y34C probably benign Het
Gm9964 T C 11: 79,187,234 (GRCm39) E71G unknown Het
Gnal G A 18: 67,324,474 (GRCm39) D210N probably damaging Het
Gnas A G 2: 174,140,166 (GRCm39) S112G probably benign Het
Gnat3 A C 5: 18,220,321 (GRCm39) S228R probably damaging Het
Golgb1 A C 16: 36,740,104 (GRCm39) E2814D probably damaging Het
Gorab C G 1: 163,213,892 (GRCm39) S346T possibly damaging Het
Gorab C A 1: 163,231,119 (GRCm39) E12* probably null Het
Gpaa1 A G 15: 76,216,742 (GRCm39) E142G possibly damaging Het
Gpatch8 T A 11: 102,371,771 (GRCm39) K589I unknown Het
Gphb5 A C 12: 75,462,581 (GRCm39) L3V unknown Het
Gpr141b C T 13: 19,913,379 (GRCm39) noncoding transcript Het
Gpr26 AC A 7: 131,585,823 (GRCm39) probably null Het
Gpr75 T G 11: 30,841,139 (GRCm39) L15V probably benign Het
Gprasp1 G T X: 134,700,190 (GRCm39) A128S possibly damaging Het
Gpsm2 T C 3: 108,608,076 (GRCm39) E234G probably damaging Het
Grid1 G A 14: 35,174,251 (GRCm39) R631H probably damaging Het
Grm3 A C 5: 9,620,183 (GRCm39) F354V probably damaging Het
Grpel1 C T 5: 36,627,958 (GRCm39) R80C probably damaging Het
Gsdmd T G 15: 75,735,323 (GRCm39) D22E probably benign Het
Gtf2f2 C T 14: 76,135,063 (GRCm39) G221S probably damaging Het
Guca1a T C 17: 47,711,335 (GRCm39) I4V probably benign Het
Gucy2c G A 6: 136,720,979 (GRCm39) P406L probably benign Het
Gykl1 T A 18: 52,827,237 (GRCm39) Y148* probably null Het
H2-T22 G A 17: 36,352,530 (GRCm39) R132W probably benign Het
Hao2 A C 3: 98,782,668 (GRCm39) V340G probably damaging Het
Hapln1 A G 13: 89,749,617 (GRCm39) H54R probably benign Het
Haus6 A C 4: 86,521,111 (GRCm39) L176V possibly damaging Het
Hc T G 2: 34,898,261 (GRCm39) T1145P possibly damaging Het
Hc T A 2: 34,919,482 (GRCm39) D668V probably benign Het
Hccs C G X: 168,096,608 (GRCm39) R199T probably damaging Het
Hdac9 T G 12: 34,457,788 (GRCm39) K255T probably damaging Het
Hdlbp G A 1: 93,359,076 (GRCm39) probably benign Het
Heatr5a G A 12: 51,938,187 (GRCm39) A1497V probably damaging Het
Heatr5a T C 12: 51,997,859 (GRCm39) T347A probably benign Het
Hectd4 A T 5: 121,433,566 (GRCm39) probably null Het
Heph T A X: 95,509,637 (GRCm39) V130D probably damaging Het
Hephl1 A T 9: 14,965,017 (GRCm39) L1126H probably damaging Het
Herc2 T G 7: 55,865,129 (GRCm39) V4202G possibly damaging Het
Herc2 G A 7: 55,781,040 (GRCm39) G1235D probably benign Het
Herc2 G A 7: 55,737,089 (GRCm39) A183T probably benign Het
Herc2 G T 7: 55,876,337 (GRCm39) C4450F probably damaging Het
Herc2 C A 7: 55,865,180 (GRCm39) A4219D probably damaging Het
Heyl GGAAGAAG GGAAG 4: 123,133,974 (GRCm39) probably benign Het
Hgf C T 5: 16,823,917 (GRCm39) R705C probably damaging Het
Hip1r A T 5: 124,137,195 (GRCm39) probably null Het
Hipk1 T C 3: 103,671,860 (GRCm39) E413G possibly damaging Het
Hipk3 G A 2: 104,264,974 (GRCm39) S702F probably damaging Het
Hmcn1 G T 1: 150,524,688 (GRCm39) A3414D probably damaging Het
Hmcn2 C A 2: 31,349,076 (GRCm39) probably null Het
Hmcn2 G T 2: 31,271,079 (GRCm39) E1252D probably benign Het
Hmg20b C G 10: 81,182,407 (GRCm39) A310P probably damaging Het
Hnrnpab T G 11: 51,492,573 (GRCm39) probably benign Het
Hoxa6 G C 6: 52,183,525 (GRCm39) F173L possibly damaging Het
Hoxc4 A T 15: 102,943,189 (GRCm39) D14V probably damaging Het
Hpdl G C 4: 116,678,030 (GRCm39) P144A probably damaging Het
Hsd3b6 T G 3: 98,713,648 (GRCm39) K217T probably benign Het
Hsf2 A T 10: 57,372,264 (GRCm39) K72N probably damaging Het
Hsf3 G T X: 95,363,922 (GRCm39) S193* probably null Het
Hsf3 A T X: 95,363,923 (GRCm39) S250T possibly damaging Het
Hspa13 C T 16: 75,555,073 (GRCm39) G338S probably benign Het
Hspa4l C G 3: 40,721,425 (GRCm39) S282* probably null Het
Hydin AGGG AGG 8: 111,319,423 (GRCm39) probably null Het
Hydin A G 8: 111,026,605 (GRCm39) K108E probably benign Het
Hydin G T 8: 111,312,680 (GRCm39) K4140N probably benign Het
I830077J02Rik C A 3: 105,834,529 (GRCm39) A42S probably damaging Het
Iars1 G A 13: 49,874,564 (GRCm39) S746N probably benign Het
Ifi203 A T 1: 173,756,147 (GRCm39) probably benign Het
Ifi206 T G 1: 173,301,577 (GRCm39) E700D probably damaging Het
Ifi209 A C 1: 173,464,973 (GRCm39) K34N probably damaging Het
Ifi209 A G 1: 173,468,712 (GRCm39) K181E probably benign Het
Ifi211 A T 1: 173,735,226 (GRCm39) F68I possibly damaging Het
Ifna16 C A 4: 88,594,615 (GRCm39) S160I probably damaging Het
Ift52 A C 2: 162,865,278 (GRCm39) D43A possibly damaging Het
Ift70b T G 2: 75,768,326 (GRCm39) E142D probably benign Het
Ighv13-2 G T 12: 114,321,435 (GRCm39) Y82* probably null Het
Ighv1-37 A T 12: 114,860,244 (GRCm39) probably benign Het
Ighv15-2 T G 12: 114,528,424 (GRCm39) D43A probably damaging Het
Ighv1-69 A C 12: 115,586,873 (GRCm39) S87A probably benign Het
Ighv5-9-1 C G 12: 113,699,740 (GRCm39) C124S probably damaging Het
Ighv7-4 A C 12: 114,186,517 (GRCm39) V85G probably damaging Het
Igkv12-98 C A 6: 68,548,015 (GRCm39) T48N probably benign Het
Igkv18-36 C A 6: 69,969,483 (GRCm39) V104F probably damaging Het
Igkv2-112 G A 6: 68,197,631 (GRCm39) S101N possibly damaging Het
Igkv5-48 C A 6: 69,703,675 (GRCm39) G77W probably damaging Het
Igsf10 C T 3: 59,237,359 (GRCm39) V941I possibly damaging Het
Ik C T 18: 36,877,835 (GRCm39) R4* probably null Het
Il11 G A 7: 4,778,998 (GRCm39) S44F probably damaging Het
Il18r1 C A 1: 40,517,646 (GRCm39) S136Y probably damaging Het
Il18r1 A C 1: 40,513,911 (GRCm39) K39T probably damaging Het
Il3ra G A 14: 14,351,129 (GRCm38) R217Q probably benign Het
Inpp4b G A 8: 82,795,560 (GRCm39) probably null Het
Inpp5f C G 7: 128,296,673 (GRCm39) T381R probably benign Het
Insm2 C G 12: 55,646,582 (GRCm39) P109A probably damaging Het
Ints11 G A 4: 155,971,427 (GRCm39) D292N probably benign Het
Ipo13 T C 4: 117,761,877 (GRCm39) E441G probably benign Het
Iqub C T 6: 24,500,242 (GRCm39) probably null Het
Itga2 G A 13: 114,993,868 (GRCm39) P762S possibly damaging Het
Itga7 T A 10: 128,785,032 (GRCm39) I787N probably benign Het
Itgb1 T G 8: 129,439,850 (GRCm39) F180V probably damaging Het
Itgb6 C T 2: 60,450,555 (GRCm39) R628Q probably null Het
Itk A C 11: 46,244,689 (GRCm39) probably null Het
Itpr3 C T 17: 27,332,502 (GRCm39) S1782L possibly damaging Het
Itsn2 A C 12: 4,762,472 (GRCm39) S1578R probably damaging Het
Izumo3 C T 4: 92,035,170 (GRCm39) A16T probably damaging Het
Jag1 C A 2: 136,927,071 (GRCm39) W896L probably benign Het
Jakmip1 A T 5: 37,278,330 (GRCm39) I536F probably damaging Het
Jmjd1c T C 10: 67,073,953 (GRCm39) L1896P probably benign Het
Jmy T A 13: 93,577,589 (GRCm39) S860C probably damaging Het
Jph2 G C 2: 163,239,252 (GRCm39) S65R possibly damaging Het
Jrk T C 15: 74,579,243 (GRCm39) K14R unknown Het
Kat6a C T 8: 23,425,517 (GRCm39) R1021* probably null Het
Kbtbd11 C G 8: 15,077,839 (GRCm39) P146R probably damaging Het
Kcna3 C A 3: 106,944,269 (GRCm39) F177L probably damaging Het
Kcna7 T G 7: 45,056,383 (GRCm39) F200V probably benign Het
Kcna7 A T 7: 45,058,529 (GRCm39) K272M probably damaging Het
Kcnb1 G C 2: 167,029,981 (GRCm39) A188G probably benign Het
Kcnb2 A C 1: 15,780,315 (GRCm39) I396L probably benign Het
Kcnb2 C T 1: 15,781,252 (GRCm39) S708L probably benign Het
Kcnh5 C T 12: 74,944,535 (GRCm39) A905T probably benign Het
Kcnh5 A C 12: 75,012,069 (GRCm39) F617V possibly damaging Het
Kcnh6 T G 11: 105,899,874 (GRCm39) F48V probably damaging Het
Kcnh7 G A 2: 63,014,412 (GRCm39) R4C probably damaging Het
Kcnh7 A C 2: 62,566,447 (GRCm39) L828R probably damaging Het
Kcnh8 A G 17: 53,285,320 (GRCm39) S1097G probably benign Het
Kcnh8 G C 17: 53,032,918 (GRCm39) K68N probably damaging Het
Kcnj15 A G 16: 95,096,978 (GRCm39) K200R probably damaging Het
Kcnk9 T A 15: 72,417,864 (GRCm39) T89S possibly damaging Het
Kcnn3 A T 3: 89,574,437 (GRCm39) S650C probably damaging Het
Kcnq5 G A 1: 21,527,753 (GRCm39) P440L probably damaging Het
Kcnt2 G T 1: 140,501,384 (GRCm39) D917Y probably damaging Het
Kcnt2 G A 1: 140,511,896 (GRCm39) W1017* probably null Het
Kctd19 A C 8: 106,111,967 (GRCm39) L826R probably benign Het
Kctd2 A G 11: 115,312,813 (GRCm39) E115G possibly damaging Het
Khdrbs2 T C 1: 32,283,136 (GRCm39) probably benign Het
Khsrp C T 17: 57,331,249 (GRCm39) R443Q probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,089,660 (GRCm39) probably benign Het
Kif18b T G 11: 102,798,983 (GRCm39) K739N probably benign Het
Kif20b G C 19: 34,927,851 (GRCm39) E1038Q probably damaging Het
Kif24 C A 4: 41,395,091 (GRCm39) S594I probably damaging Het
Kif27 T G 13: 58,435,847 (GRCm39) Q1315H probably benign Het
Klhl22 T G 16: 17,594,407 (GRCm39) F179V possibly damaging Het
Klhl26 T G 8: 70,904,449 (GRCm39) E426A probably damaging Het
Klhl41 A C 2: 69,505,074 (GRCm39) K459T possibly damaging Het
Klk1b1 A C 7: 43,619,825 (GRCm39) K128T probably benign Het
Klk1b26 A T 7: 43,665,420 (GRCm39) Q109H probably benign Het
Klk1b3 G A 7: 43,849,729 (GRCm39) W38* probably null Het
Klk1b9 G A 7: 43,443,735 (GRCm39) G83D probably damaging Het
Klk6 T C 7: 43,477,912 (GRCm39) S95P probably benign Het
Klra2 A C 6: 131,205,253 (GRCm39) L196R probably damaging Het
Klrh1 T C 6: 129,749,426 (GRCm39) probably null Het
Kmt2b G T 7: 30,284,676 (GRCm39) Q739K probably benign Het
Kprp G A 3: 92,732,364 (GRCm39) Q229* probably null Het
Kptn T C 7: 15,856,995 (GRCm39) L161P probably damaging Het
Kri1 C A 9: 21,185,418 (GRCm39) E639D probably benign Het
Krt32 C T 11: 99,979,042 (GRCm39) S4N probably benign Het
Krt36 A T 11: 99,995,015 (GRCm39) L186M possibly damaging Het
Krt75 C G 15: 101,482,100 (GRCm39) G56A probably benign Het
Krt76 A G 15: 101,798,986 (GRCm39) L233P probably damaging Het
Krt78 C T 15: 101,855,766 (GRCm39) E682K possibly damaging Het
Krtap20-1 G A 16: 88,881,053 (GRCm39) C28Y unknown Het
Ksr1 G C 11: 78,935,705 (GRCm39) probably null Het
Ksr2 A C 5: 117,885,467 (GRCm39) T764P probably damaging Het
Lama1 G T 17: 68,117,166 (GRCm39) G2487V probably damaging Het
Lama1 G A 17: 68,078,077 (GRCm39) G1171S probably benign Het
Lama1 G A 17: 68,059,878 (GRCm39) D656N probably benign Het
Large1 C T 8: 73,638,731 (GRCm39) W282* probably null Het
Lce1e A G 3: 92,615,156 (GRCm39) C64R unknown Het
Lce1f T C 3: 92,626,561 (GRCm39) K32R unknown Het
Lce1i C A 3: 92,684,596 (GRCm39) probably null Het
Lefty2 A T 1: 180,725,280 (GRCm39) R337W probably damaging Het
Lelp1 T A 3: 92,042,905 (GRCm39) K48M unknown Het
Lenep C G 3: 89,309,876 (GRCm39) G24A probably damaging Het
Lgr6 C T 1: 134,915,809 (GRCm39) G313E possibly damaging Het
Lhb A C 7: 45,071,154 (GRCm39) probably null Het
Lipo2 T C 19: 33,699,085 (GRCm39) Y315C probably damaging Het
Lmbr1 C A 5: 29,528,814 (GRCm39) A110S probably damaging Het
Lmtk2 A G 5: 144,119,669 (GRCm39) S1377G probably benign Het
Lpcat2b C T 5: 107,581,177 (GRCm39) P169S probably damaging Het
Lpin3 T C 2: 160,734,151 (GRCm39) F12S probably damaging Het
Lrfn3 A C 7: 30,059,626 (GRCm39) F200V probably damaging Het
Lrif1 G A 3: 106,639,886 (GRCm39) D324N probably benign Het
Lrp1 G A 10: 127,420,248 (GRCm39) R912C probably damaging Het
Lrp10 A C 14: 54,705,379 (GRCm39) T190P probably benign Het
Lrpprc G A 17: 85,039,212 (GRCm39) Q923* probably null Het
Lrpprc C T 17: 85,077,928 (GRCm39) probably null Het
Lrrc18 C T 14: 32,730,467 (GRCm39) A2V probably damaging Het
Lrrc28 T G 7: 67,179,379 (GRCm39) K329T possibly damaging Het
Lrrc30 T C 17: 67,938,690 (GRCm39) K297E possibly damaging Het
Lrrc32 G A 7: 98,148,267 (GRCm39) R349K probably benign Het
Lrrc45 G T 11: 120,611,057 (GRCm39) V572F probably damaging Het
Lrrc52 C A 1: 167,294,063 (GRCm39) G74V possibly damaging Het
Lrrc63 C T 14: 75,363,430 (GRCm39) E234K possibly damaging Het
Lrrfip1 GAAGAACAAGAA GAAGAA 1: 91,043,252 (GRCm39) probably benign Het
Lrriq1 T A 10: 103,038,307 (GRCm39) N832I probably damaging Het
Lrrk2 T G 15: 91,610,443 (GRCm39) V725G probably benign Het
Ltbp4 C T 7: 27,007,217 (GRCm39) A1364T probably damaging Het
Luc7l T G 17: 26,486,229 (GRCm39) L136R probably damaging Het
Luc7l2 A C 6: 38,580,304 (GRCm39) probably benign Het
Lypd8 A C 11: 58,277,556 (GRCm39) T113P possibly damaging Het
Lyst A T 13: 13,918,018 (GRCm39) Q3359H probably benign Het
Lyzl1 A C 18: 4,181,156 (GRCm39) K114T probably damaging Het
Magel2 G T 7: 62,028,725 (GRCm39) R543L possibly damaging Het
Mak16 A G 8: 31,656,123 (GRCm39) L120P probably damaging Het
Man2b2 C T 5: 36,972,700 (GRCm39) D605N possibly damaging Het
Map10 CGGG CGG 8: 126,398,670 (GRCm39) probably null Het
Map1b T G 13: 99,644,623 (GRCm39) E93D probably benign Het
Map1s T G 8: 71,369,093 (GRCm39) F881V possibly damaging Het
Map3k3 G A 11: 106,041,179 (GRCm39) D383N possibly damaging Het
Map3k6 C G 4: 132,972,377 (GRCm39) H318D probably damaging Het
Mapk13 A G 17: 28,996,507 (GRCm39) E245G possibly damaging Het
Mapkapk5 C T 5: 121,669,654 (GRCm39) E115K probably benign Het
Marchf10 C A 11: 105,281,185 (GRCm39) G367W probably damaging Het
Marveld3 G A 8: 110,674,695 (GRCm39) R374C possibly damaging Het
Mast4 T G 13: 102,875,027 (GRCm39) K1255T probably damaging Het
Maz GGCCCTG GG 7: 126,623,646 (GRCm39) probably null Het
Mcf2 T C X: 59,224,073 (GRCm39) H65R probably benign Het
Mcm6 T G 1: 128,272,035 (GRCm39) N454T probably damaging Het
Mcpt4 T A 14: 56,297,967 (GRCm39) R195* probably null Het
Mdm1 A C 10: 117,994,267 (GRCm39) K380N possibly damaging Het
Mdm4 A G 1: 132,922,285 (GRCm39) S286P probably benign Het
Med13l C A 5: 118,887,706 (GRCm39) T1660K probably damaging Het
Med14 A C X: 12,543,845 (GRCm39) L1451R probably damaging Het
Megf11 A T 9: 64,567,758 (GRCm39) S416C probably damaging Het
Megf8 G A 7: 25,039,094 (GRCm39) E902K possibly damaging Het
Mep1a C G 17: 43,802,487 (GRCm39) W192C probably damaging Het
Mfap3 T A 11: 57,418,968 (GRCm39) F43I possibly damaging Het
Mfhas1 C G 8: 36,057,390 (GRCm39) P622A probably benign Het
Mgam G C 6: 40,619,994 (GRCm39) V28L probably benign Het
Mgp T G 6: 136,851,261 (GRCm39) probably null Het
Micall2 A C 5: 139,702,050 (GRCm39) L398V probably benign Het
Micall2 T A 5: 139,692,649 (GRCm39) K908M probably damaging Het
Mill2 G A 7: 18,590,324 (GRCm39) probably null Het
Mir1966 C T 8: 106,342,203 (GRCm39) R130* probably null Het
Mkrn1 T A 6: 39,377,390 (GRCm39) N282Y probably null Het
Mkx C T 18: 6,936,975 (GRCm39) A319T probably damaging Het
Mn1 T A 5: 111,566,146 (GRCm39) F39I possibly damaging Het
Morc2b A T 17: 33,355,060 (GRCm39) I904N possibly damaging Het
Mpo T G 11: 87,686,071 (GRCm39) F74V probably benign Het
Mpv17l2 T G 8: 71,212,056 (GRCm39) K139T probably damaging Het
Mrgprb4 A G 7: 47,848,430 (GRCm39) L166P possibly damaging Het
Mrgprg C G 7: 143,318,393 (GRCm39) A240P probably damaging Het
Mrgprx1 T G 7: 47,670,877 (GRCm39) K290T probably damaging Het
Mroh5 G A 15: 73,659,880 (GRCm39) A320V possibly damaging Het
Mrpl1 T G 5: 96,409,928 (GRCm39) M267R probably damaging Het
Mrpl2 A G 17: 46,958,404 (GRCm39) K62R probably null Het
Mrps36 T G 13: 100,875,641 (GRCm39) S58R possibly damaging Het
Msantd3 A C 4: 48,552,525 (GRCm39) D38A probably damaging Het
Mta1 C T 12: 113,096,820 (GRCm39) P547L probably benign Het
Mta3 A G 17: 84,070,343 (GRCm39) D16G probably benign Het
Mtcl1 C T 17: 66,650,723 (GRCm39) A1132T probably benign Het
Mtf2 A G 5: 108,235,195 (GRCm39) D139G probably damaging Het
Mthfd1l T G 10: 3,957,844 (GRCm39) F294V probably benign Het
Mtus2 G A 5: 148,240,073 (GRCm39) probably benign Het
Muc4 A T 16: 32,576,450 (GRCm39) probably benign Het
Muc5ac A C 7: 141,365,429 (GRCm39) T1984P possibly damaging Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Muc5b A G 7: 141,415,951 (GRCm39) S2966G probably benign Het
Mup3 G C 4: 62,005,426 (GRCm39) L15V unknown Het
Mvd G C 8: 123,166,469 (GRCm39) A56G probably benign Het
Mvk G T 5: 114,596,995 (GRCm39) G321W probably damaging Het
Mxra7 G T 11: 116,695,432 (GRCm39) N157K probably benign Het
Mybpc2 T C 7: 44,165,927 (GRCm39) K256R possibly damaging Het
Mybpc3 A G 2: 90,965,704 (GRCm39) E1172G probably benign Het
Myh11 AGG AG 16: 14,087,126 (GRCm39) probably null Het
Myh2 GTATTTATTTA GTATTTA 11: 67,071,589 (GRCm39) probably benign Het
Myh2 C T 11: 67,082,275 (GRCm39) L1326F probably damaging Het
Myh6 C T 14: 55,194,454 (GRCm39) R725H probably damaging Het
Myh8 A C 11: 67,189,418 (GRCm39) K1198T probably damaging Het
Myh9 A G 15: 77,659,458 (GRCm39) L96P probably damaging Het
Myo18b C T 5: 112,905,350 (GRCm39) E2083K probably benign Het
Myo18b G A 5: 112,840,809 (GRCm39) S2328L possibly damaging Het
Myo1d T G 11: 80,565,724 (GRCm39) N367T probably benign Het
Myo5b G C 18: 74,877,820 (GRCm39) E1606D probably benign Het
Myo5c C G 9: 75,152,341 (GRCm39) S76R probably damaging Het
Myorg A C 4: 41,497,557 (GRCm39) L691R probably benign Het
Myrf C A 19: 10,198,662 (GRCm39) Q195H probably damaging Het
Nacc1 G C 8: 85,399,915 (GRCm39) A434G probably damaging Het
Naip2 A T 13: 100,298,417 (GRCm39) Y540N probably benign Het
Nap1l2 T G X: 102,228,802 (GRCm39) N372T probably damaging Het
Nat8 G T 6: 85,808,175 (GRCm39) probably benign Het
Nav1 T C 1: 135,398,462 (GRCm39) T707A probably benign Het
Nbea G A 3: 55,630,584 (GRCm39) T2251I probably benign Het
Nbeal2 G C 9: 110,461,440 (GRCm39) A1536G possibly damaging Het
Ncapg T G 5: 45,837,222 (GRCm39) L431R probably damaging Het
Nck2 A C 1: 43,593,543 (GRCm39) N250T possibly damaging Het
Nckap5 G A 1: 125,952,569 (GRCm39) R1264C possibly damaging Het
Nckipsd G C 9: 108,691,876 (GRCm39) K492N probably benign Het
Ncor2 T A 5: 125,144,852 (GRCm39) S597C unknown Het
Ncor2 C T 5: 125,163,904 (GRCm39) probably null Het
Ndn T G 7: 61,998,882 (GRCm39) F243V probably damaging Het
Ndufs6 A G 13: 73,476,555 (GRCm39) V4A probably benign Het
Neb T A 2: 52,198,579 (GRCm39) K423M probably damaging Het
Neb C T 2: 52,059,884 (GRCm39) V2321I possibly damaging Het
Neb G C 2: 52,113,164 (GRCm39) P7A probably benign Het
Nedd4 G A 9: 72,577,360 (GRCm39) V62M probably benign Het
Nek7 C A 1: 138,443,363 (GRCm39) V197L probably null Het
Nelfcd GTT GT 2: 174,268,287 (GRCm39) probably null Het
Nell2 A T 15: 95,332,978 (GRCm39) L194M probably damaging Het
Neurod6 G A 6: 55,656,347 (GRCm39) Q97* probably null Het
Nfkbiz T C 16: 55,638,599 (GRCm39) Y287C probably damaging Het
Nfkbiz G C 16: 55,636,801 (GRCm39) A500G probably damaging Het
Nfrkb A C 9: 31,322,629 (GRCm39) S900R possibly damaging Het
Nhsl3 C T 4: 129,116,091 (GRCm39) A903T probably damaging Het
Nipbl T A 15: 8,337,366 (GRCm39) E2065D probably damaging Het
Nkapl C G 13: 21,652,473 (GRCm39) G47R unknown Het
Nlrc5 A G 8: 95,231,092 (GRCm39) D1275G possibly damaging Het
Nlrp12 T C 7: 3,271,211 (GRCm39) K1034R probably benign Het
Nlrp14 T G 7: 106,785,829 (GRCm39) L635R probably damaging Het
Nlrp3 G C 11: 59,442,686 (GRCm39) S746T possibly damaging Het
Nlrp4a T C 7: 26,153,588 (GRCm39) V713A probably benign Het
Nlrp4c A C 7: 6,069,635 (GRCm39) K512T probably damaging Het
Nlrp4f C T 13: 65,342,116 (GRCm39) E510K probably benign Het
Nlrp4g T G 9: 124,349,201 (GRCm38) noncoding transcript Het
Nlrp9b T G 7: 19,757,668 (GRCm39) F302V probably benign Het
Nme8 T A 13: 19,873,127 (GRCm39) E172D possibly damaging Het
Nnt G A 13: 119,474,982 (GRCm39) S649L probably damaging Het
Nod2 G C 8: 89,390,774 (GRCm39) Q345H probably damaging Het
Nol4 C T 18: 23,054,959 (GRCm39) S157N probably damaging Het
Nolc1 G T 19: 46,071,537 (GRCm39) probably benign Het
Notch1 T G 2: 26,367,127 (GRCm39) D680A probably damaging Het
Notch3 C G 17: 32,377,626 (GRCm39) G150A possibly damaging Het
Notch4 C T 17: 34,806,889 (GRCm39) P1942L probably damaging Het
Nr3c2 C A 8: 77,635,261 (GRCm39) Q121K possibly damaging Het
Nr4a2 C T 2: 57,001,626 (GRCm39) G213S probably damaging Het
Nrg1 G C 8: 32,408,033 (GRCm39) L67V possibly damaging Het
Nrxn1 T A 17: 90,366,933 (GRCm39) D31V probably damaging Het
Nsd1 A C 13: 55,361,661 (GRCm39) S210R possibly damaging Het
Nsd2 T C 5: 34,013,082 (GRCm39) probably null Het
Nsd3 CCTTCT CCT 8: 26,131,018 (GRCm39) probably benign Het
Nsun2 A T 13: 69,763,584 (GRCm39) K103M probably damaging Het
Ntn5 G C 7: 45,343,627 (GRCm39) G322A probably damaging Het
Nudt4 C T 10: 95,388,377 (GRCm39) G60S probably benign Het
Numa1 C A 7: 101,647,609 (GRCm39) Q447K probably benign Het
Numa1 T G 7: 101,647,538 (GRCm39) L423R probably damaging Het
Nup214 T C 2: 31,901,235 (GRCm39) F940L probably benign Het
Nxpe5 G A 5: 138,239,176 (GRCm39) probably null Het
Nxph2 G T 2: 23,290,229 (GRCm39) A194S probably benign Het
Oaz1 C G 10: 80,662,663 (GRCm39) R24G possibly damaging Het
Obox2 A G 7: 15,131,263 (GRCm39) K123R possibly damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Oca2 G T 7: 55,980,123 (GRCm39) K609N probably null Het
Ocln G A 13: 100,671,560 (GRCm39) R266* probably null Het
Ocstamp C A 2: 165,237,838 (GRCm39) Q475H possibly damaging Het
Odad2 G A 18: 7,266,919 (GRCm39) S394L probably benign Het
Odf1 A G 15: 38,219,918 (GRCm39) Y82C probably benign Het
Ogdh A C 11: 6,305,427 (GRCm39) D978A probably benign Het
Olfm3 G T 3: 114,698,317 (GRCm39) probably benign Het
Olfm5 T G 7: 103,803,357 (GRCm39) S294R probably damaging Het
Omg G C 11: 79,393,146 (GRCm39) N237K possibly damaging Het
Oog3 T A 4: 143,884,877 (GRCm39) N353I probably benign Het
Oog3 A G 4: 143,886,206 (GRCm39) F131L probably benign Het
Or10a2 C A 7: 106,673,612 (GRCm39) D192E possibly damaging Het
Or10a3m T G 7: 108,312,745 (GRCm39) F50V probably benign Het
Or10a3n G T 7: 108,492,980 (GRCm39) F211L probably damaging Het
Or10a48 A C 7: 108,425,103 (GRCm39) Y34* probably null Het
Or10ag52 T G 2: 87,044,122 (GRCm39) I295M possibly damaging Het
Or10ag54 G T 2: 87,099,919 (GRCm39) G265* probably null Het
Or10ag58 A G 2: 87,265,503 (GRCm39) Y224C probably damaging Het
Or10ag59 T C 2: 87,406,024 (GRCm39) S199P possibly damaging Het
Or10ak8 A C 4: 118,773,785 (GRCm39) L293R probably damaging Het
Or10al4 T A 17: 38,036,983 (GRCm39) F23I probably damaging Het
Or10g9b A G 9: 39,917,892 (GRCm39) S118P probably damaging Het
Or10j5 T A 1: 172,784,891 (GRCm39) F176L probably damaging Het
Or10q12 C A 19: 13,745,780 (GRCm39) P25T probably benign Het
Or10x1 G A 1: 174,197,310 (GRCm39) V276I probably benign Het
Or11g26 T C 14: 50,752,984 (GRCm39) F108L possibly damaging Het
Or12d13 A C 17: 37,647,596 (GRCm39) F176V probably damaging Het
Or12e10 C A 2: 87,641,090 (GRCm39) L309I probably damaging Het
Or12j5 A C 7: 140,083,718 (GRCm39) V218G probably benign Het
Or13a27 A G 7: 139,925,717 (GRCm39) F62L probably benign Het
Or13a28 A G 7: 140,218,133 (GRCm39) K173R probably benign Het
Or13p3 A G 4: 118,567,423 (GRCm39) K273R probably benign Het
Or14c43 T A 7: 86,114,954 (GRCm39) F112I possibly damaging Het
Or14j10 G T 17: 37,935,320 (GRCm39) L69M probably damaging Het
Or1e17 G A 11: 73,831,964 (GRCm39) M297I probably benign Het
Or1e19 T C 11: 73,315,931 (GRCm39) S293G probably benign Het
Or1j12 T G 2: 36,342,918 (GRCm39) F107C possibly damaging Het
Or1l4b T G 2: 37,036,397 (GRCm39) F58V probably benign Het
Or1p1 T C 11: 74,179,661 (GRCm39) L63P probably damaging Het
Or1q1 A C 2: 36,887,717 (GRCm39) K298N possibly damaging Het
Or2ag12 T G 7: 106,277,664 (GRCm39) S10R probably benign Het
Or2ag15 A T 7: 106,340,350 (GRCm39) S264T probably benign Het
Or2ag2 T A 7: 106,485,503 (GRCm39) I174F probably damaging Het
Or2d36 A C 7: 106,747,419 (GRCm39) S299R probably benign Het
Or2l13 T C 16: 19,305,798 (GRCm39) L70P possibly damaging Het
Or2y15 T G 11: 49,351,283 (GRCm39) L259R probably damaging Het
Or2z9 T G 8: 72,854,361 (GRCm39) F252L probably benign Het
Or3a1 A T 11: 74,225,518 (GRCm39) F180I probably damaging Het
Or4c110 C A 2: 88,832,182 (GRCm39) G150V possibly damaging Het
Or4c12 A G 2: 89,774,114 (GRCm39) V115A probably benign Het
Or4d10b T C 19: 12,036,493 (GRCm39) T208A probably benign Het
Or4e2 C A 14: 52,688,666 (GRCm39) F265L probably benign Het
Or4f53 T G 2: 111,088,204 (GRCm39) V248G possibly damaging Het
Or4k41 T C 2: 111,279,802 (GRCm39) F106L probably benign Het
Or4k44 A C 2: 111,368,159 (GRCm39) I158M possibly damaging Het
Or4p23 A C 2: 88,576,922 (GRCm39) F103L probably damaging Het
Or4s2b T G 2: 88,509,008 (GRCm39) F263V probably damaging Het
Or51a42 A C 7: 103,708,523 (GRCm39) S95R possibly damaging Het
Or51ah3 G C 7: 103,210,597 (GRCm39) L304F probably damaging Het
Or51ah3 A G 7: 103,210,266 (GRCm39) K194R probably benign Het
Or52e15 C A 7: 104,645,661 (GRCm39) G150V probably benign Het
Or52n2b G T 7: 104,565,873 (GRCm39) A210E probably benign Het
Or52s1b A G 7: 102,822,013 (GRCm39) L277P possibly damaging Het
Or52z1 T G 7: 103,436,572 (GRCm39) K304T probably damaging Het
Or52z15 T G 7: 103,332,393 (GRCm39) I156S probably benign Het
Or56b2j T C 7: 104,353,700 (GRCm39) Y309H probably benign Het
Or5an6 A C 19: 12,371,663 (GRCm39) K12T probably benign Het
Or5an9 A C 19: 12,187,854 (GRCm39) K308T possibly damaging Het
Or5b101 A C 19: 13,005,391 (GRCm39) F101V probably benign Het
Or5b116 T C 19: 13,423,213 (GRCm39) V279A possibly damaging Het
Or5b121 T G 19: 13,507,216 (GRCm39) F104V possibly damaging Het
Or5b124 C A 19: 13,610,817 (GRCm39) A114E probably damaging Het
Or5b21 T C 19: 12,839,648 (GRCm39) C170R probably damaging Het
Or5bb10 C A 19: 12,206,588 (GRCm39) W107C probably damaging Het
Or5d16 G A 2: 87,773,792 (GRCm39) P60L probably damaging Het
Or5e1 T G 7: 108,354,311 (GRCm39) L83V probably benign Het
Or5g26 C T 2: 85,493,960 (GRCm39) V273I probably benign Het
Or5i1 G T 2: 87,612,972 (GRCm39) L29F probably damaging Het
Or5j1 A C 2: 86,878,777 (GRCm39) L268V probably benign Het
Or5m13b T G 2: 85,754,142 (GRCm39) F177V probably damaging Het
Or5m3b T C 2: 85,872,063 (GRCm39) S135P probably damaging Het
Or5m9b G T 2: 85,905,667 (GRCm39) E194D possibly damaging Het
Or5p56 G A 7: 107,589,938 (GRCm39) R122H probably benign Het
Or5p57 C A 7: 107,665,534 (GRCm39) C127F probably damaging Het
Or5p73 T A 7: 108,064,578 (GRCm39) F16I probably benign Het
Or5p76 A C 7: 108,122,605 (GRCm39) F184C probably damaging Het
Or5t5 A G 2: 86,616,817 (GRCm39) K248E probably damaging Het
Or5w16 G T 2: 87,576,833 (GRCm39) A98S probably damaging Het
Or5w20 G A 2: 87,726,977 (GRCm39) A145T probably benign Het
Or6c201 T G 10: 128,968,944 (GRCm39) K231T probably benign Het
Or6c214 A C 10: 129,591,208 (GRCm39) I37S possibly damaging Het
Or6c217 T C 10: 129,738,552 (GRCm39) E9G possibly damaging Het
Or6c74 A C 10: 129,869,657 (GRCm39) K54T probably damaging Het
Or6k6 C T 1: 173,944,881 (GRCm39) A234T probably benign Het
Or6n2 C T 1: 173,897,515 (GRCm39) S217F probably damaging Het
Or7d10 T A 9: 19,832,008 (GRCm39) F168I probably damaging Het
Or7e173 A G 9: 19,938,575 (GRCm39) S220P probably damaging Het
Or7g19 G A 9: 18,856,717 (GRCm39) V258I possibly damaging Het
Or7g29 G A 9: 19,286,980 (GRCm39) L66F probably damaging Het
Or8b101 T C 9: 38,020,882 (GRCm39) V295A probably damaging Het
Or8b46 T C 9: 38,450,445 (GRCm39) F85L probably damaging Het
Or8b47 T G 9: 38,435,155 (GRCm39) N42K probably damaging Het
Or8b9 A C 9: 37,766,614 (GRCm39) S167R probably benign Het
Or8c17 T C 9: 38,179,908 (GRCm39) L33S probably damaging Het
Or8g17 A C 9: 38,930,085 (GRCm39) F251V probably damaging Het
Or8g28 G A 9: 39,169,167 (GRCm39) S270L probably benign Het
Or8h9 T G 2: 86,789,010 (GRCm39) K264T probably benign Het
Or8k23 A T 2: 86,186,237 (GRCm39) I163N probably benign Het
Or8k24 T G 2: 86,216,523 (GRCm39) K80Q probably damaging Het
Or8k24 T C 2: 86,216,100 (GRCm39) I221V probably benign Het
Or8k3 C A 2: 86,058,566 (GRCm39) V250F probably damaging Het
Or8k33 C T 2: 86,384,310 (GRCm39) A53T probably benign Het
Or8u10 C T 2: 85,915,326 (GRCm39) S265N probably benign Het
Or9g8 T G 2: 85,607,466 (GRCm39) D179E probably damaging Het
Or9i14 A C 19: 13,792,912 (GRCm39) L14R probably damaging Het
Or9m1 A C 2: 87,733,928 (GRCm39) F31V possibly damaging Het
Or9s27 T A 1: 92,516,273 (GRCm39) S74T probably damaging Het
Orc2 A C 1: 58,515,675 (GRCm39) F230V probably benign Het
Osbpl3 A G 6: 50,274,077 (GRCm39) F846L probably damaging Het
Pabpc1l G C 2: 163,874,244 (GRCm39) probably null Het
Pah C T 10: 87,407,153 (GRCm39) S303F probably damaging Het
Paip2b T G 6: 83,785,864 (GRCm39) N122T probably benign Het
Pak4 G T 7: 28,264,653 (GRCm39) T83N probably damaging Het
Pamr1 C A 2: 102,464,791 (GRCm39) F313L possibly damaging Het
Papln C G 12: 83,823,150 (GRCm39) P396A probably benign Het
Papss1 C G 3: 131,348,728 (GRCm39) H559Q possibly damaging Het
Parp14 C G 16: 35,661,956 (GRCm39) D1360H probably damaging Het
Pask C T 1: 93,244,523 (GRCm39) S1166N probably damaging Het
Pbk T A 14: 66,051,397 (GRCm39) V145D probably damaging Het
Pbrm1 G A 14: 30,832,411 (GRCm39) R1443Q possibly damaging Het
Pcbp3 C A 10: 76,599,157 (GRCm39) Q326H probably benign Het
Pcdh1 G C 18: 38,331,120 (GRCm39) R767G probably damaging Het
Pcdh17 A G 14: 84,685,714 (GRCm39) K727R possibly damaging Het
Pcdha2 G T 18: 37,074,174 (GRCm39) G602C probably damaging Het
Pcdha6 G A 18: 37,102,270 (GRCm39) A488T probably damaging Het
Pcdhac1 G T 18: 37,225,243 (GRCm39) L685F probably damaging Het
Pcdhac1 G T 18: 37,225,619 (GRCm39) A811S probably damaging Het
Pcdhb21 A G 18: 37,647,594 (GRCm39) E241G probably benign Het
Pcdhb22 A C 18: 37,652,398 (GRCm39) T289P probably benign Het
Pcdhb6 T A 18: 37,468,199 (GRCm39) D373E probably damaging Het
Pcdhga11 G C 18: 37,889,237 (GRCm39) G82R probably damaging Het
Pcmtd1 C T 1: 7,233,554 (GRCm39) P222L possibly damaging Het
Pcnx2 C T 8: 126,553,667 (GRCm39) E1151K probably damaging Het
Pcnx2 T G 8: 126,592,757 (GRCm39) S736R probably damaging Het
Pcsk5 A G 19: 17,440,738 (GRCm39) L1284P probably damaging Het
Pdgfra C T 5: 75,327,238 (GRCm39) S145F probably benign Het
Pdrg1 C T 2: 152,855,957 (GRCm39) A46T probably damaging Het
Pds5a A C 5: 65,776,329 (GRCm39) I88M probably damaging Het
Pdzk1 A G 3: 96,761,873 (GRCm39) N162D probably benign Het
Peds1 G C 2: 167,486,784 (GRCm39) Y198* probably null Het
Pelp1 A G 11: 70,287,716 (GRCm39) L402P probably damaging Het
Pex1 G A 5: 3,656,075 (GRCm39) A301T probably benign Het
Pex6 A T 17: 47,023,148 (GRCm39) Q241H possibly damaging Het
Pgap4 A G 4: 49,587,135 (GRCm39) L11P probably damaging Het
Pgm3 A G 9: 86,446,760 (GRCm39) F253L probably damaging Het
Phaf1 C T 8: 105,957,804 (GRCm39) R37C probably damaging Het
Pi4k2b G A 5: 52,918,273 (GRCm39) R367Q possibly damaging Het
Pi4kb T G 3: 94,891,820 (GRCm39) F179V probably damaging Het
Pid1 T G 1: 84,093,735 (GRCm39) N51T probably benign Het
Piezo2 C T 18: 63,203,065 (GRCm39) G1525D probably damaging Het
Piga A C X: 163,205,905 (GRCm39) K88N probably damaging Het
Pigo G C 4: 43,019,409 (GRCm39) P970A probably damaging Het
Pik3r6 G A 11: 68,416,428 (GRCm39) V6M probably damaging Het
Piwil4 G A 9: 14,645,813 (GRCm39) H142Y probably damaging Het
Pkd1 T G 17: 24,784,579 (GRCm39) L375R probably benign Het
Pkd2 T G 5: 104,646,727 (GRCm39) L780V probably damaging Het
Pkdcc A G 17: 83,529,579 (GRCm39) E380G probably damaging Het
Pla2g12a C T 3: 129,684,029 (GRCm39) S136F probably benign Het
Pla2g2c T C 4: 138,461,597 (GRCm39) F22S probably damaging Het
Pla2g4c A T 7: 13,063,678 (GRCm39) Q48H probably benign Het
Plb1 T G 5: 32,468,191 (GRCm39) F503V probably damaging Het
Plb1 C T 5: 32,468,261 (GRCm39) S526L probably benign Het
Plcb1 A C 2: 135,062,766 (GRCm39) E27D probably benign Het
Plcl2 C A 17: 50,914,020 (GRCm39) P343H probably damaging Het
Pld1 A C 3: 28,083,392 (GRCm39) I171L probably benign Het
Plod2 T G 9: 92,485,088 (GRCm39) F551V probably benign Het
Plxna2 A C 1: 194,326,749 (GRCm39) I228L possibly damaging Het
Plxna2 A G 1: 194,446,847 (GRCm39) N786D probably benign Het
Plxnd1 C A 6: 115,944,471 (GRCm39) S1033I probably benign Het
Pmfbp1 A C 8: 110,240,576 (GRCm39) E219D probably damaging Het
Pml G T 9: 58,141,873 (GRCm39) L320M probably damaging Het
Pnisr C G 4: 21,873,684 (GRCm39) R476G probably benign Het
Pnliprp2 G A 19: 58,750,757 (GRCm39) A149T probably damaging Het
Pnp T G 14: 51,188,952 (GRCm39) D248E probably benign Het
Pnpla5 A G 15: 84,007,272 (GRCm39) S15P probably damaging Het
Pogz T A 3: 94,786,387 (GRCm39) F992I probably damaging Het
Pole C T 5: 110,475,731 (GRCm39) L1847F possibly damaging Het
Polr2b T G 5: 77,490,569 (GRCm39) I903S possibly damaging Het
Polr2b G A 5: 77,493,248 (GRCm39) G1077S probably damaging Het
Polr3a A C 14: 24,529,792 (GRCm39) V266G probably damaging Het
Pop1 C G 15: 34,499,465 (GRCm39) A10G probably damaging Het
Pop7 T C 5: 137,500,273 (GRCm39) Y20C probably damaging Het
Postn A T 3: 54,282,548 (GRCm39) D503V probably benign Het
Pou4f2 C G 8: 79,162,230 (GRCm39) Q124H probably benign Het
Ppl G A 16: 4,907,371 (GRCm39) R975W probably damaging Het
Ppp1cc C T 5: 122,310,816 (GRCm39) S182F possibly damaging Het
Ppp1r10 ACATGATGTCCCTAGCCAT ACAT 17: 36,241,659 (GRCm39) probably benign Het
Ppp1r7 T C 1: 93,280,310 (GRCm39) L126P probably damaging Het
Ppp2r1b A C 9: 50,778,211 (GRCm39) E309D probably damaging Het
Ppp4r3c1 T G X: 88,973,842 (GRCm39) D785A unknown Het
Ppp4r3c1 C A X: 88,973,843 (GRCm39) D785Y unknown Het
Pramel18 A G 4: 101,766,315 (GRCm39) probably null Het
Pramel18 A C 4: 101,767,383 (GRCm39) I211L probably benign Het
Pramel21 C A 4: 143,341,802 (GRCm39) A77E possibly damaging Het
Pramel23 T G 4: 143,424,650 (GRCm39) Q264H probably benign Het
Pramel24 T C 4: 143,453,603 (GRCm39) L237P probably damaging Het
Pramel28 C T 4: 143,692,132 (GRCm39) E290K probably benign Het
Pramel58 C A 5: 94,831,692 (GRCm39) A233E probably benign Het
Prdm1 G A 10: 44,317,921 (GRCm39) R301W probably damaging Het
Prg2 G T 2: 84,812,609 (GRCm39) K106N possibly damaging Het
Prkg2 A T 5: 99,172,663 (GRCm39) H17Q probably benign Het
Prob1 G C 18: 35,785,822 (GRCm39) P811A possibly damaging Het
Prox1 G C 1: 189,894,196 (GRCm39) A83G probably damaging Het
Prr23a1 G A 9: 98,725,400 (GRCm39) R254Q possibly damaging Het
Prr27 G A 5: 87,990,505 (GRCm39) R31H probably damaging Het
Prr30 G C 14: 101,435,576 (GRCm39) Q329E probably benign Het
Prrc2b G A 2: 32,106,744 (GRCm39) R1582K probably damaging Het
Prrc2b C A 2: 32,104,441 (GRCm39) N1306K probably benign Het
Prrx1 A C 1: 163,089,446 (GRCm39) L127R probably damaging Het
Prss36 G A 7: 127,533,709 (GRCm39) R32* probably null Het
Prss53 C T 7: 127,486,570 (GRCm39) W352* probably null Het
Psd3 T C 8: 68,358,912 (GRCm39) silent Het
Psg17 G A 7: 18,550,835 (GRCm39) T340I probably benign Het
Psg25 T A 7: 18,263,516 (GRCm39) R102S probably benign Het
Psmd11 A ATC 11: 80,362,376 (GRCm39) probably null Het
Ptcra G C 17: 47,074,521 (GRCm39) A7G probably damaging Het
Pten A C 19: 32,777,398 (GRCm39) T131P probably damaging Het
Pten C T 19: 32,753,451 (GRCm39) A39V probably damaging Het
Ptgfrn T G 3: 100,963,753 (GRCm39) T620P probably damaging Het
Ptgr3 G A 18: 84,113,052 (GRCm39) V243I probably damaging Het
Ptprn T A 1: 75,237,264 (GRCm39) M20L possibly damaging Het
Ptprq C T 10: 107,535,533 (GRCm39) A411T possibly damaging Het
Ptprt A G 2: 162,080,041 (GRCm39) S253P possibly damaging Het
Rab3gap2 A T 1: 185,013,874 (GRCm39) L1173F probably damaging Het
Rac1 C A 5: 143,500,474 (GRCm39) A59S probably damaging Het
Rad21 T G 15: 51,846,022 (GRCm39) K16T probably damaging Het
Rad21l C T 2: 151,509,939 (GRCm39) R54Q probably damaging Het
Rad9b A G 5: 122,471,435 (GRCm39) F210L possibly damaging Het
Raet1e A C 10: 22,057,850 (GRCm39) T206P possibly damaging Het
Ralgapa2 T G 2: 146,276,825 (GRCm39) S472R probably benign Het
Ranbp2 AGTTTGTGCTCGGT AGTTTGTGCTCGGTTTGTGCTCGGT 10: 58,313,794 (GRCm39) probably null Het
Ranbp2 A T 10: 58,328,715 (GRCm39) Q2871H probably benign Het
Ranbp2 GGT GGTTTGTGCTCCGT 10: 58,313,805 (GRCm39) probably null Het
Rapgefl1 C G 11: 98,736,721 (GRCm39) P285R probably damaging Het
Rasgrp4 A C 7: 28,849,961 (GRCm39) probably benign Het
Rassf7 C G 7: 140,797,058 (GRCm39) S90R probably damaging Het
Rassf8 A C 6: 145,762,342 (GRCm39) E371A probably benign Het
Rassf8 A G 6: 145,761,208 (GRCm39) Q178R probably benign Het
Rb1cc1 AT ATT 1: 6,319,242 (GRCm39) probably null Het
Rbm12b1 G T 4: 12,146,079 (GRCm39) V684L probably benign Het
Rdh16f1 A C 10: 127,624,702 (GRCm39) K180T probably damaging Het
Rec8 A T 14: 55,862,604 (GRCm39) K553M probably damaging Het
Reg1 G T 6: 78,403,901 (GRCm39) E23* probably null Het
Rergl C A 6: 139,470,424 (GRCm39) E135* probably null Het
Resp18 T C 1: 75,254,935 (GRCm39) K6R possibly damaging Het
Rev3l C A 10: 39,700,314 (GRCm39) Q1604K probably benign Het
Rfc3 C T 5: 151,568,327 (GRCm39) R213H probably benign Het
Rfwd3 C A 8: 112,024,238 (GRCm39) G28V probably benign Het
Rfx3 G A 19: 27,814,850 (GRCm39) S169F probably damaging Het
Rfx8 T G 1: 39,722,126 (GRCm39) E286D possibly damaging Het
Rgl1 G A 1: 152,550,771 (GRCm39) probably benign Het
Rgs11 G C 17: 26,424,746 (GRCm39) Q218H probably benign Het
Rgs7 T C 1: 174,911,586 (GRCm39) E345G possibly damaging Het
Rims1 C G 1: 22,358,810 (GRCm39) A1258P probably damaging Het
Rint1 A G 5: 24,010,312 (GRCm39) N174D probably benign Het
Ripk3 T G 14: 56,025,383 (GRCm39) E60D possibly damaging Het
Rnf146 G A 10: 29,223,568 (GRCm39) A106V probably damaging Het
Rnf213 A G 11: 119,368,080 (GRCm39) K4705R possibly damaging Het
Rnmt C T 18: 68,440,745 (GRCm39) S136L probably benign Het
Rp1l1 C T 14: 64,266,207 (GRCm39) H598Y possibly damaging Het
Rp1l1 T G 14: 64,267,827 (GRCm39) F1138V probably benign Het
Rpgrip1l T G 8: 91,987,603 (GRCm39) K818T possibly damaging Het
Rpgrip1l A T 8: 91,996,748 (GRCm39) F109I possibly damaging Het
Rpgrip1l A T 8: 91,946,807 (GRCm39) *1265R probably null Het
Rpl12 T A 2: 32,853,031 (GRCm39) I82N possibly damaging Het
Rpl13a G C 7: 44,776,937 (GRCm39) A24G probably damaging Het
Rpp14 A C 14: 8,090,539 (GRCm38) E154D probably benign Het
Rps19 G C 7: 24,585,532 (GRCm39) probably benign Het
Rptn C A 3: 93,304,734 (GRCm39) P689H probably benign Het
Rrbp1 C A 2: 143,816,406 (GRCm39) G741V probably damaging Het
Rreb1 G A 13: 38,132,913 (GRCm39) R1696K probably benign Het
Rsl1d1 C T 16: 11,020,249 (GRCm39) G59R possibly damaging Het
Rtl1 T A 12: 109,558,753 (GRCm39) T1029S probably benign Het
Runx1 C T 16: 92,402,680 (GRCm39) A421T probably damaging Het
Runx1t1 G A 4: 13,865,892 (GRCm39) R380Q possibly damaging Het
Rxfp1 C T 3: 79,613,011 (GRCm39) G20R probably damaging Het
Ryr3 C A 2: 112,731,261 (GRCm39) G683V probably damaging Het
S100a13 C G 3: 90,423,249 (GRCm39) S80C probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 84,725,625 (GRCm39) probably benign Het
Satb1 C G 17: 52,089,967 (GRCm39) Q293H probably damaging Het
Satb1 G A 17: 52,089,980 (GRCm39) S289F probably damaging Het
Sbno1 T G 5: 124,532,021 (GRCm39) K719N possibly damaging Het
Sbno1 G T 5: 124,542,367 (GRCm39) P308T probably damaging Het
Sbpl A C 17: 24,172,518 (GRCm39) F134V probably damaging Het
Sbsn G T 7: 30,451,176 (GRCm39) E64* probably null Het
Scaf8 T G 17: 3,213,258 (GRCm39) probably benign Het
Scap A G 9: 110,201,404 (GRCm39) N131S probably damaging Het
Scarf1 C T 11: 75,416,316 (GRCm39) A586V probably damaging Het
Scd1 C A 19: 44,386,362 (GRCm39) S355I probably benign Het
Scgb2b26 A C 7: 33,643,792 (GRCm39) F49L probably benign Het
Scn11a A G 9: 119,584,308 (GRCm39) F1436L probably damaging Het
Scn7a C T 2: 66,544,295 (GRCm39) E399K probably damaging Het
Scrib G A 15: 75,920,080 (GRCm39) P1560S probably damaging Het
Sctr GT G 1: 119,964,136 (GRCm39) probably null Het
Sec16a G A 2: 26,329,105 (GRCm39) S970F probably damaging Het
Sec16b A G 1: 157,385,594 (GRCm39) probably null Het
Sec23a A G 12: 59,051,362 (GRCm39) F94L probably benign Het
Sel1l3 C A 5: 53,273,538 (GRCm39) A1081S probably damaging Het
Selenok G A 14: 29,695,401 (GRCm39) G93E probably damaging Het
Selenov G A 7: 27,990,093 (GRCm39) T137I possibly damaging Het
Sema3b A C 9: 107,476,233 (GRCm39) probably null Het
Sema3e G A 5: 14,276,470 (GRCm39) S285N probably damaging Het
Sema5b T G 16: 35,480,960 (GRCm39) F815V probably damaging Het
Serac1 G A 17: 6,099,193 (GRCm39) P533S probably damaging Het
Serpina1a C A 12: 103,820,926 (GRCm39) probably null Het
Serpinb3b T G 1: 107,085,481 (GRCm39) T87P probably damaging Het
Serpinb6c A G 13: 34,077,855 (GRCm39) F172L probably damaging Het
Serpinb6c G A 13: 34,077,906 (GRCm39) P155S probably benign Het
Serpinb6d T C 13: 33,855,237 (GRCm39) F304L possibly damaging Het
Sertad4 G T 1: 192,529,339 (GRCm39) T159N probably damaging Het
Setbp1 G C 18: 78,902,809 (GRCm39) P286R probably damaging Het
Sez6 T G 11: 77,864,023 (GRCm39) F502V possibly damaging Het
Sez6l T G 5: 112,588,781 (GRCm39) Q644P probably damaging Het
Sfmbt2 A C 2: 10,583,994 (GRCm39) T784P probably damaging Het
Sgo2b T G 8: 64,381,456 (GRCm39) T459P possibly damaging Het
Sgo2b C A 8: 64,380,039 (GRCm39) G931V probably damaging Het
Sgtb T C 13: 104,268,447 (GRCm39) L118P probably damaging Het
Shank1 C T 7: 44,001,590 (GRCm39) A1103V unknown Het
Siglech A G 7: 55,418,742 (GRCm39) I182V possibly damaging Het
Sirpa C A 2: 129,460,455 (GRCm39) A54D probably damaging Het
Slamf1 T G 1: 171,627,160 (GRCm39) V334G probably damaging Het
Slc14a2 T G 18: 78,238,995 (GRCm39) K208T probably damaging Het
Slc15a1 C T 14: 121,717,466 (GRCm39) R272Q probably benign Het
Slc15a1 A G 14: 121,728,456 (GRCm39) L65P probably damaging Het
Slc15a2 A G 16: 36,772,445 (GRCm38) M179T probably benign Het
Slc1a5 C T 7: 16,531,594 (GRCm39) P533L probably damaging Het
Slc22a12 G A 19: 6,588,493 (GRCm39) H342Y possibly damaging Het
Slc22a2 G A 17: 12,833,663 (GRCm39) E448K probably benign Het
Slc22a28 A C 19: 8,039,763 (GRCm39) S537A probably damaging Het
Slc22a3 A T 17: 12,644,568 (GRCm39) C472* probably null Het
Slc22a30 C A 19: 8,313,139 (GRCm39) V549F probably damaging Het
Slc22a6 A G 19: 8,599,197 (GRCm39) D276G probably benign Het
Slc23a1 T C 18: 35,757,561 (GRCm39) N237D probably benign Het
Slc25a1 C G 16: 17,745,070 (GRCm39) G130A probably benign Het
Slc28a1 C G 7: 80,787,916 (GRCm39) P268A probably damaging Het
Slc2a6 G A 2: 26,911,999 (GRCm39) P420L probably damaging Het
Slc35a4 A C 18: 36,816,146 (GRCm39) *325Y probably null Het
Slc48a1 C A 15: 97,688,562 (GRCm39) Y74* probably null Het
Slc4a10 T G 2: 62,058,915 (GRCm39) L141V probably damaging Het
Slc4a8 C G 15: 100,659,832 (GRCm39) P8A probably benign Het
Slc6a19 C T 13: 73,837,849 (GRCm39) E217K possibly damaging Het
Slc6a5 C G 7: 49,561,605 (GRCm39) P46A probably benign Het
Slc7a14 G C 3: 31,278,148 (GRCm39) L486V probably benign Het
Slco2a1 C A 9: 102,956,726 (GRCm39) L513M probably benign Het
Slit2 A G 5: 48,459,695 (GRCm39) Y1308C probably damaging Het
Slurp2 C A 15: 74,614,950 (GRCm39) V64L probably damaging Het
Slx9 C A 10: 77,325,865 (GRCm39) S168I probably damaging Het
Smad5 A T 13: 56,876,441 (GRCm39) R258S probably benign Het
Smarcc2 G C 10: 128,297,303 (GRCm39) G65A probably damaging Het
Smco1 A T 16: 32,092,033 (GRCm39) D37V probably damaging Het
Smg1 A C 7: 117,753,858 (GRCm39) probably benign Het
Smg1 A G 7: 117,777,622 (GRCm39) L1358P possibly damaging Het
Smg1 C A 7: 117,767,884 (GRCm39) E1665* probably null Het
Smim29 G A 17: 27,783,215 (GRCm39) R51C possibly damaging Het
Snx15 T C 19: 6,171,441 (GRCm39) E211G probably damaging Het
Snx5 C T 2: 144,094,411 (GRCm39) R373Q probably benign Het
Sod2 T A 17: 13,232,425 (GRCm39) L150H probably damaging Het
Sorcs1 C G 19: 50,210,581 (GRCm39) Q761H probably benign Het
Sox12 C G 2: 152,239,385 (GRCm39) W78C probably damaging Het
Sox17 G T 1: 4,562,525 (GRCm39) S160Y probably damaging Het
Sp9 G C 2: 73,103,574 (GRCm39) A43P possibly damaging Het
Spag17 A G 3: 100,002,946 (GRCm39) K1890R probably benign Het
Speer1c T C 5: 10,293,097 (GRCm39) probably benign Het
Speer4b C G 5: 27,702,939 (GRCm39) E188D probably benign Het
Speer4f1 A C 5: 17,684,477 (GRCm39) E168D probably damaging Het
Spen C A 4: 141,205,287 (GRCm39) E1113D unknown Het
Spen T C 4: 141,205,288 (GRCm39) E1113G unknown Het
Sphkap T G 1: 83,256,325 (GRCm39) T475P probably damaging Het
Sphkap T A 1: 83,254,329 (GRCm39) N1140I probably damaging Het
Spinkl G C 18: 44,307,626 (GRCm39) L12V probably damaging Het
Spire1 C A 18: 67,628,222 (GRCm39) R509L possibly damaging Het
Spon1 G A 7: 113,365,623 (GRCm39) A20T possibly damaging Het
Srd5a3 T C 5: 76,297,668 (GRCm39) F33L possibly damaging Het
Srebf2 T G 15: 82,079,122 (GRCm39) F783L probably benign Het
Srp68 TCCGCCGCCGCCGCCGC TCCGCCGCCGCCGCCGCCGCCGC 11: 116,164,861 (GRCm39) probably benign Het
Ssbp4 A C 8: 71,052,485 (GRCm39) probably benign Het
Ssc5d A C 7: 4,931,433 (GRCm39) E213D probably damaging Het
Ssh2 C A 11: 77,340,321 (GRCm39) T491N probably damaging Het
Ssrp1 G A 2: 84,870,997 (GRCm39) R211H probably damaging Het
Ssxb3 T G X: 8,455,427 (GRCm39) S5R probably benign Het
Stam C A 2: 14,143,901 (GRCm39) S397* probably null Het
Stambpl1 A T 19: 34,204,027 (GRCm39) N39I probably damaging Het
Stap2 G C 17: 56,306,748 (GRCm39) A275G probably benign Het
Stard4 T C 18: 33,336,773 (GRCm39) S181G probably benign Het
Stard4 G T 18: 33,336,770 (GRCm39) Q182K probably benign Het
Stil T G 4: 114,863,890 (GRCm39) L44R probably damaging Het
Stk31 G T 6: 49,394,122 (GRCm39) probably null Het
Ston2 T G 12: 91,615,841 (GRCm39) N189T possibly damaging Het
Stxbp5l T G 16: 37,024,851 (GRCm39) Q582H probably benign Het
Styxl2 A G 1: 165,926,852 (GRCm39) L920P probably damaging Het
Sult2a1 T C 7: 13,535,339 (GRCm39) Q238R probably benign Het
Sult2a1 A T 7: 13,535,360 (GRCm39) F231Y probably benign Het
Sult2a1 T C 7: 13,537,961 (GRCm39) I187M probably benign Het
Sult2a6 T C 7: 13,959,819 (GRCm39) Q238R probably benign Het
Sycp2 C T 2: 178,023,727 (GRCm39) V430I probably benign Het
Sycp2 T G 2: 178,016,160 (GRCm39) E767D probably benign Het
Syna C T 5: 134,587,383 (GRCm39) R522Q probably benign Het
Syne4 C G 7: 30,015,761 (GRCm39) S125C probably damaging Het
Syngap1 A C 17: 27,180,550 (GRCm39) D653A probably damaging Het
Synm A C 7: 67,401,634 (GRCm39) L285V probably damaging Het
Synpo2l T G 14: 20,716,035 (GRCm39) E183D probably damaging Het
Syt10 C T 15: 89,725,842 (GRCm39) G44D probably benign Het
Szrd1 C A 4: 140,845,898 (GRCm39) R99L probably damaging Het
Taar9 G C 10: 23,984,863 (GRCm39) C190W probably damaging Het
Tab2 A T 10: 7,796,030 (GRCm39) S77T possibly damaging Het
Taf1a G T 1: 183,185,614 (GRCm39) R291M possibly damaging Het
Taf5l C A 8: 124,724,077 (GRCm39) G581* probably null Het
Tars1 G T 15: 11,391,970 (GRCm39) P255H probably benign Het
Tas1r2 C T 4: 139,387,735 (GRCm39) A398V possibly damaging Het
Tas2r109 T C 6: 132,957,264 (GRCm39) Q222R probably benign Het
Tas2r115 G T 6: 132,714,044 (GRCm39) C302* probably null Het
Tas2r116 A G 6: 132,832,911 (GRCm39) N171D probably benign Het
Tbc1d1 A G 5: 64,432,736 (GRCm39) probably null Het
Tbc1d13 T C 2: 30,024,884 (GRCm39) probably null Het
Tbc1d4 A C 14: 101,689,859 (GRCm39) V1049G probably damaging Het
Tbc1d5 C A 17: 51,270,724 (GRCm39) R169I probably damaging Het
Tbxa2r G C 10: 81,169,049 (GRCm39) G246A probably damaging Het
Tcaim A C 9: 122,662,722 (GRCm39) K430T probably benign Het
Tchh C T 3: 93,352,989 (GRCm39) Q810* probably null Het
Tcp10a G C 17: 7,593,848 (GRCm39) A58P probably damaging Het
Tctn1 C G 5: 122,389,704 (GRCm39) A273P probably damaging Het
Tctn3 A C 19: 40,595,790 (GRCm39) F332V possibly damaging Het
Tdrd6 T G 17: 43,937,409 (GRCm39) E1213A probably benign Het
Tead4 G C 6: 128,247,867 (GRCm39) R57G probably damaging Het
Teddm1a G A 1: 153,767,772 (GRCm39) G79R probably benign Het
Tekt5 G A 16: 10,176,241 (GRCm39) R435W probably damaging Het
Tenm1 G A X: 41,988,712 (GRCm39) P290S probably damaging Het
Tenm2 C T 11: 36,164,094 (GRCm39) A384T probably damaging Het
Terf2 A G 8: 107,807,855 (GRCm39) L240P probably damaging Het
Tex13c2 A T X: 41,579,439 (GRCm39) S211C probably damaging Het
Tex15 A C 8: 34,061,343 (GRCm39) K532Q possibly damaging Het
Tex15 A G 8: 34,064,898 (GRCm39) N1443D probably benign Het
Tex15 A G 8: 34,061,838 (GRCm39) I697V possibly damaging Het
Them6 G A 15: 74,593,418 (GRCm39) R92H probably benign Het
Thsd1 G A 8: 22,742,235 (GRCm39) R301H probably damaging Het
Thumpd3 C G 6: 113,032,991 (GRCm39) T243S probably benign Het
Tiam2 C T 17: 3,465,294 (GRCm39) S341F probably benign Het
Tie1 A G 4: 118,341,626 (GRCm39) C229R probably damaging Het
Timm44 C T 8: 4,318,004 (GRCm39) E135K probably benign Het
Tlr11 T G 14: 50,599,795 (GRCm39) F594V possibly damaging Het
Tlr4 G A 4: 66,847,319 (GRCm39) D149N probably benign Het
Tm9sf3 A G 19: 41,220,817 (GRCm39) Y382H probably damaging Het
Tm9sf5 A C X: 56,533,998 (GRCm39) I668L probably benign Het
Tmc3 A C 7: 83,252,676 (GRCm39) K359T probably damaging Het
Tmem132a G A 19: 10,836,299 (GRCm39) R744C probably damaging Het
Tmem132c G A 5: 127,581,985 (GRCm39) S400N probably benign Het
Tmem198 C A 1: 75,456,906 (GRCm39) Q11K probably benign Het
Tmem219 G C 7: 126,490,846 (GRCm39) P198A possibly damaging Het
Tmem270 A C 5: 134,935,510 (GRCm39) L15R probably damaging Het
Tmem39a C A 16: 38,396,140 (GRCm39) F124L possibly damaging Het
Tmem39b C G 4: 129,586,270 (GRCm39) A4P probably benign Het
Tmem45b A G 9: 31,339,323 (GRCm39) F131L probably damaging Het
Tmppe G A 9: 114,234,145 (GRCm39) R148H probably benign Het
Tmprss4 T A 9: 45,086,763 (GRCm39) N333Y probably damaging Het
Tnni3k G C 3: 154,645,307 (GRCm39) A526G probably damaging Het
Tnpo1 C G 13: 98,997,178 (GRCm39) G417A probably benign Het
Tnpo3 C G 6: 29,565,842 (GRCm39) G504A probably benign Het
Tnr T C 1: 159,722,665 (GRCm39) F1037L probably benign Het
Tnrc6b C T 15: 80,811,891 (GRCm39) R813* probably null Het
Togaram2 A G 17: 72,021,275 (GRCm39) K687R possibly damaging Het
Tox C A 4: 6,688,450 (GRCm39) R519M probably damaging Het
Tpo T C 12: 30,144,781 (GRCm39) D656G probably damaging Het
Trank1 G A 9: 111,193,778 (GRCm39) D601N probably damaging Het
Trav13d-4 C G 14: 53,310,627 (GRCm39) T76S probably benign Het
Trav16n C T 14: 53,589,030 (GRCm39) A101V possibly damaging Het
Trav5-4 A G 14: 53,941,696 (GRCm39) E23G possibly damaging Het
Trav8d-2 T G 14: 53,280,265 (GRCm39) L85R probably damaging Het
Tril G A 6: 53,795,905 (GRCm39) T439M probably benign Het
Trim30a C A 7: 104,084,861 (GRCm39) W116C probably damaging Het
Trim30b C A 7: 104,015,307 (GRCm39) S27I probably damaging Het
Trim42 T G 9: 97,251,675 (GRCm39) N75H probably benign Het
Trim43c A C 9: 88,724,988 (GRCm39) probably null Het
Trim45 A C 3: 100,832,956 (GRCm39) E396D probably benign Het
Trim5 C T 7: 103,915,432 (GRCm39) A294T possibly damaging Het
Trim67 A G 8: 125,543,780 (GRCm39) Q380R probably damaging Het
Triml1 T A 8: 43,583,435 (GRCm39) I389F probably damaging Het
Trip12 A C 1: 84,743,889 (GRCm39) N500K probably damaging Het
Trip4 G A 9: 65,771,697 (GRCm39) R278* probably null Het
Trp53bp1 T C 2: 121,084,126 (GRCm39) K247E probably benign Het
Trp63 G A 16: 25,582,063 (GRCm39) R37K probably benign Het
Trpm7 G T 2: 126,639,201 (GRCm39) A1711E probably damaging Het
Trrap A G 5: 144,771,007 (GRCm39) K2802R probably benign Het
Tspan5 G C 3: 138,604,087 (GRCm39) W228C possibly damaging Het
Tssk4 A G 14: 55,888,380 (GRCm39) K83R probably damaging Het
Ttbk1 C A 17: 46,757,251 (GRCm39) A1128S probably benign Het
Ttc16 C A 2: 32,659,345 (GRCm39) L251F probably damaging Het
Ttc23l C A 15: 10,533,753 (GRCm39) R263S probably damaging Het
Ttc28 G C 5: 111,434,181 (GRCm39) G2405A probably benign Het
Ttc39c G T 18: 12,820,020 (GRCm39) M15I possibly damaging Het
Ttll1 C T 15: 83,382,390 (GRCm39) V201I probably damaging Het
Ttll12 T C 15: 83,466,279 (GRCm39) Q394R probably damaging Het
Ttll2 T G 17: 7,618,925 (GRCm39) D334A probably damaging Het
Ttn T G 2: 76,678,669 (GRCm39) probably benign Het
Ttn T G 2: 76,617,613 (GRCm39) K14540T probably damaging Het
Ttn A G 2: 76,582,863 (GRCm39) W20931R probably damaging Het
Ttn G T 2: 76,582,574 (GRCm39) A14446E probably damaging Het
Ttn C G 2: 76,577,295 (GRCm39) E24533Q probably damaging Het
Ttn T G 2: 76,569,031 (GRCm39) E25541D possibly damaging Het
Tubal3 A C 13: 3,983,511 (GRCm39) E430D probably benign Het
Tubb3 G C 8: 124,148,273 (GRCm39) G402A probably damaging Het
Tubd1 A T 11: 86,445,993 (GRCm39) K211M probably damaging Het
Tubd1 G A 11: 86,440,296 (GRCm39) G107S probably damaging Het
Tubgcp5 G A 7: 55,464,849 (GRCm39) G577S probably benign Het
Tulp2 A C 7: 45,171,410 (GRCm39) K404T probably damaging Het
Tyro3 T G 2: 119,639,948 (GRCm39) I377S probably benign Het
Ube4b A G 4: 149,419,582 (GRCm39) I1042T possibly damaging Het
Ubl4b T G 3: 107,461,719 (GRCm39) E180D unknown Het
Ubqln5 T A 7: 103,778,178 (GRCm39) K215N possibly damaging Het
Ubqlnl A G 7: 103,799,200 (GRCm39) V99A probably damaging Het
Ubr3 A G 2: 69,752,711 (GRCm39) T322A probably benign Het
Uggt1 A C 1: 36,213,272 (GRCm39) F861C probably damaging Het
Ugt1a10 T C 1: 87,983,564 (GRCm39) F121L probably benign Het
Umps CCTGACTGA CCTGA 16: 33,787,195 (GRCm39) probably null Het
Unc13a C A 8: 72,107,447 (GRCm39) probably null Het
Unc5c T G 3: 141,439,661 (GRCm39) L111V probably damaging Het
Unc79 C A 12: 102,987,271 (GRCm39) H187N probably damaging Het
Unc80 C G 1: 66,685,610 (GRCm39) P2245A possibly damaging Het
Ush2a T C 1: 188,644,180 (GRCm39) L4514P probably benign Het
Ush2a A C 1: 188,679,201 (GRCm39) N4803T probably benign Het
Usp17lb G A 7: 104,490,336 (GRCm39) P197L probably benign Het
Usp43 C A 11: 67,746,866 (GRCm39) R942L probably benign Het
Usp51 C T X: 151,791,218 (GRCm39) P271S probably benign Het
Usp51 C T X: 151,791,219 (GRCm39) P271L probably benign Het
Vmn1r12 T G 6: 57,135,966 (GRCm39) L21R probably damaging Het
Vmn1r176 C T 7: 23,534,598 (GRCm39) R185H probably benign Het
Vmn1r179 A G 7: 23,627,907 (GRCm39) I33V probably benign Het
Vmn1r188 T C 13: 22,272,450 (GRCm39) W135R probably damaging Het
Vmn1r212 A C 13: 23,067,932 (GRCm39) F134V probably damaging Het
Vmn1r229 C A 17: 21,035,327 (GRCm39) L191M probably damaging Het
Vmn1r232 C A 17: 21,134,100 (GRCm39) V167F probably benign Het
Vmn1r4 G A 6: 56,934,050 (GRCm39) V185M possibly damaging Het
Vmn1r46 A G 6: 89,953,723 (GRCm39) R191G probably damaging Het
Vmn1r72 T G 7: 11,404,100 (GRCm39) N116T probably benign Het
Vmn1r78 A C 7: 11,886,641 (GRCm39) K84T probably damaging Het
Vmn2r10 A G 5: 109,143,979 (GRCm39) F657S probably damaging Het
Vmn2r101 C A 17: 19,809,237 (GRCm39) A122D possibly damaging Het
Vmn2r103 C A 17: 20,015,309 (GRCm39) S483Y probably benign Het
Vmn2r108 C T 17: 20,691,375 (GRCm39) V383M probably benign Het
Vmn2r110 T G 17: 20,803,942 (GRCm39) H211P probably damaging Het
Vmn2r112 C G 17: 22,824,059 (GRCm39) S438C possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r12 G T 5: 109,240,646 (GRCm39) H156N probably benign Het
Vmn2r16 TA T 5: 109,511,779 (GRCm39) probably null Het
Vmn2r16 A C 5: 109,488,381 (GRCm39) Q418P probably benign Het
Vmn2r19 T G 6: 123,285,298 (GRCm39) L3V probably benign Het
Vmn2r23 A C 6: 123,719,067 (GRCm39) T807P probably damaging Het
Vmn2r24 A C 6: 123,781,155 (GRCm39) S454R probably benign Het
Vmn2r45 T A 7: 8,474,484 (GRCm39) E848V probably benign Het
Vmn2r5 T G 3: 64,416,963 (GRCm39) N65T probably benign Het
Vmn2r50 G C 7: 9,771,427 (GRCm39) T758R possibly damaging Het
Vmn2r50 G T 7: 9,780,086 (GRCm39) L432I probably benign Het
Vmn2r59 G T 7: 41,661,838 (GRCm39) A659E possibly damaging Het
Vmn2r61 A G 7: 41,949,388 (GRCm39) T603A possibly damaging Het
Vmn2r63 G A 7: 42,577,983 (GRCm39) T185I probably benign Het
Vmn2r65 C A 7: 84,592,473 (GRCm39) probably null Het
Vmn2r70 A C 7: 85,213,968 (GRCm39) L395V possibly damaging Het
Vmn2r79 T G 7: 86,651,549 (GRCm39) F316C probably damaging Het
Vmn2r8 A C 5: 108,949,864 (GRCm39) F328V probably damaging Het
Vmn2r82 T G 10: 79,192,456 (GRCm39) F11C probably damaging Het
Vmn2r87 C A 10: 130,308,183 (GRCm39) R685M probably damaging Het
Vmn2r90 C A 17: 17,953,879 (GRCm39) A681E probably damaging Het
Vmn2r93 A C 17: 18,546,665 (GRCm39) K846Q probably damaging Het
Vmn2r95 C A 17: 18,660,663 (GRCm39) F358L probably benign Het
Vmn2r96 T A 17: 18,817,628 (GRCm39) L594I possibly damaging Het
Vmn2r99 C A 17: 19,599,563 (GRCm39) Q416K probably benign Het
Vmo1 T A 11: 70,404,643 (GRCm39) L119F probably damaging Het
Vps13c T C 9: 67,821,257 (GRCm39) S1256P probably damaging Het
Vwa8 C T 14: 79,219,686 (GRCm39) A478V probably benign Het
Washc4 C G 10: 83,412,605 (GRCm39) A749G probably benign Het
Wbp2 T A 11: 115,977,739 (GRCm39) K5* probably null Het
Wdcp A C 12: 4,900,825 (GRCm39) K227T probably damaging Het
Wdr13 A C X: 7,991,861 (GRCm39) F369V probably damaging Het
Wdr13 C A X: 7,991,863 (GRCm39) S460I probably damaging Het
Wdr3 T G 3: 100,051,660 (GRCm39) K663T probably benign Het
Wdr36 T G 18: 32,999,065 (GRCm39) probably null Het
Wdr53 T A 16: 32,071,116 (GRCm39) S154T probably damaging Het
Wdr5b G A 16: 35,862,813 (GRCm39) A311T probably damaging Het
Wdr64 A T 1: 175,533,551 (GRCm39) Q62H possibly damaging Het
Wdr82 A C 9: 106,061,999 (GRCm39) I221L probably benign Het
Wnt5a C T 14: 28,244,685 (GRCm39) R311C probably damaging Het
Wrap53 G A 11: 69,469,324 (GRCm39) S144F probably damaging Het
Wsb2 C A 5: 117,515,571 (GRCm39) P392Q probably damaging Het
Wwc1 T G 11: 35,774,309 (GRCm39) N317T possibly damaging Het
Wwp2 G A 8: 108,281,719 (GRCm39) E303K probably damaging Het
Xdh C T 17: 74,193,423 (GRCm39) S1291N probably benign Het
Xirp1 T G 9: 120,016,907 (GRCm38) Q970P probably benign Het
Xirp2 A G 2: 67,343,665 (GRCm39) T1969A probably benign Het
Xpot A C 10: 121,437,228 (GRCm39) I830S probably damaging Het
Xylb T A 9: 119,210,680 (GRCm39) L388M probably benign Het
Yju2b G A 8: 84,985,538 (GRCm39) R244* probably null Het
Ylpm1 G A 12: 85,076,929 (GRCm39) R760K possibly damaging Het
Zbtb34 C G 2: 33,301,120 (GRCm39) E474Q probably damaging Het
Zc3h12b A C X: 94,943,048 (GRCm39) K116T probably damaging Het
Zdhhc17 T C 10: 110,781,327 (GRCm39) probably null Het
Zfat G A 15: 68,058,950 (GRCm39) A195V probably benign Het
Zfhx2 T G 14: 55,311,637 (GRCm39) Q352H possibly damaging Het
Zfhx3 A C 8: 109,677,989 (GRCm39) K3013T possibly damaging Het
Zfp106 G T 2: 120,360,971 (GRCm39) L1047I probably damaging Het
Zfp109 A G 7: 23,928,360 (GRCm39) F358L probably benign Het
Zfp157 T C 5: 138,455,461 (GRCm39) L553P probably damaging Het
Zfp273 A T 13: 67,973,513 (GRCm39) I214F possibly damaging Het
Zfp326 T A 5: 106,036,496 (GRCm39) Y136N probably damaging Het
Zfp386 G A 12: 116,018,393 (GRCm39) E21K possibly damaging Het
Zfp42 C G 8: 43,748,842 (GRCm39) V220L probably benign Het
Zfp507 C G 7: 35,493,702 (GRCm39) S447T possibly damaging Het
Zfp518b C A 5: 38,831,636 (GRCm39) S123I probably damaging Het
Zfp541 A C 7: 15,813,720 (GRCm39) K791T probably benign Het
Zfp553 G T 7: 126,834,670 (GRCm39) G75V probably damaging Het
Zfp57 T C 17: 37,321,030 (GRCm39) F295L probably damaging Het
Zfp593 G C 4: 133,972,753 (GRCm39) A21G probably benign Het
Zfp598 CCAT CCATCAT 17: 24,899,184 (GRCm39) probably benign Het
Zfp638 A C 6: 83,921,793 (GRCm39) K640T probably damaging Het
Zfp648 T C 1: 154,080,266 (GRCm39) F142L probably benign Het
Zfp729b C T 13: 67,741,189 (GRCm39) E359K possibly damaging Het
Zfp775 G A 6: 48,597,622 (GRCm39) E499K probably damaging Het
Zfp868 TTAT TT 8: 70,064,561 (GRCm39) probably null Het
Zfp959 A G 17: 56,205,135 (GRCm39) R391G probably damaging Het
Zfp976 T G 7: 42,262,184 (GRCm39) E551A possibly damaging Het
Zfp997 A G 13: 66,270,208 (GRCm39) K458R probably damaging Het
Zfp998 A C 13: 66,579,245 (GRCm39) C413G probably damaging Het
Zfp998 C T 13: 66,579,800 (GRCm39) G228S probably benign Het
Zfp999 C A 13: 66,375,170 (GRCm39) S73I probably benign Het
Zfx A C X: 93,123,049 (GRCm39) L585V probably damaging Het
Zglp1 C T 9: 20,978,296 (GRCm39) R27Q possibly damaging Het
Zhx3 GGAAG GG 2: 160,621,675 (GRCm39) probably benign Het
Zic2 A T 14: 122,716,087 (GRCm39) H403L probably damaging Het
Zim1 T G 7: 6,680,658 (GRCm39) N335T possibly damaging Het
Zkscan3 T C 13: 21,572,735 (GRCm39) K299R possibly damaging Het
Zkscan4 T G 13: 21,668,067 (GRCm39) L173V probably damaging Het
Zmiz2 A T 11: 6,349,603 (GRCm39) H421L probably damaging Het
Zmynd15 A C 11: 70,351,961 (GRCm39) K60T possibly damaging Het
Zmynd8 A C 2: 165,670,091 (GRCm39) L481R probably benign Het
Zpbp C A 11: 11,358,568 (GRCm39) R233L probably damaging Het
Zscan18 G T 7: 12,508,994 (GRCm39) Q169K probably benign Het
Zscan18 G A 7: 12,509,020 (GRCm39) probably benign Het
Zscan26 T G 13: 21,629,633 (GRCm39) K290T probably damaging Het
Other mutations in Nlrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Nlrp5 APN 7 23,141,213 (GRCm39) missense probably damaging 1.00
IGL01393:Nlrp5 APN 7 23,103,599 (GRCm39) missense probably null 0.04
IGL01505:Nlrp5 APN 7 23,117,159 (GRCm39) missense probably benign 0.15
IGL02010:Nlrp5 APN 7 23,116,797 (GRCm39) missense probably benign 0.04
IGL02223:Nlrp5 APN 7 23,129,447 (GRCm39) splice site probably benign
IGL02341:Nlrp5 APN 7 23,103,577 (GRCm39) missense probably benign 0.43
IGL02532:Nlrp5 APN 7 23,109,398 (GRCm39) missense possibly damaging 0.70
IGL02619:Nlrp5 APN 7 23,123,489 (GRCm39) critical splice donor site probably null
IGL02659:Nlrp5 APN 7 23,118,006 (GRCm39) missense probably damaging 1.00
IGL02828:Nlrp5 APN 7 23,120,885 (GRCm39) missense possibly damaging 0.81
IGL03018:Nlrp5 APN 7 23,117,172 (GRCm39) missense probably benign 0.06
IGL03164:Nlrp5 APN 7 23,117,798 (GRCm39) nonsense probably null
IGL03397:Nlrp5 APN 7 23,112,759 (GRCm39) missense probably damaging 1.00
IGL03404:Nlrp5 APN 7 23,129,459 (GRCm39) missense probably benign 0.00
R0310:Nlrp5 UTSW 7 23,129,582 (GRCm39) missense probably damaging 0.99
R0549:Nlrp5 UTSW 7 23,141,227 (GRCm39) missense probably damaging 1.00
R0573:Nlrp5 UTSW 7 23,117,056 (GRCm39) missense probably damaging 1.00
R0647:Nlrp5 UTSW 7 23,117,132 (GRCm39) missense probably damaging 1.00
R0675:Nlrp5 UTSW 7 23,116,842 (GRCm39) missense possibly damaging 0.53
R0826:Nlrp5 UTSW 7 23,117,133 (GRCm39) missense probably benign 0.13
R1511:Nlrp5 UTSW 7 23,112,772 (GRCm39) missense probably damaging 0.99
R1620:Nlrp5 UTSW 7 23,118,064 (GRCm39) missense probably damaging 1.00
R1858:Nlrp5 UTSW 7 23,117,586 (GRCm39) missense probably damaging 0.98
R1867:Nlrp5 UTSW 7 23,123,407 (GRCm39) missense possibly damaging 0.85
R1887:Nlrp5 UTSW 7 23,116,909 (GRCm39) missense probably damaging 1.00
R1899:Nlrp5 UTSW 7 23,104,222 (GRCm39) missense probably benign 0.00
R1901:Nlrp5 UTSW 7 23,123,335 (GRCm39) missense possibly damaging 0.94
R2032:Nlrp5 UTSW 7 23,120,937 (GRCm39) missense probably damaging 1.00
R3083:Nlrp5 UTSW 7 23,129,588 (GRCm39) missense probably benign 0.03
R3806:Nlrp5 UTSW 7 23,104,271 (GRCm39) missense probably benign
R3907:Nlrp5 UTSW 7 23,133,071 (GRCm39) missense possibly damaging 0.48
R4085:Nlrp5 UTSW 7 23,129,523 (GRCm39) missense probably damaging 0.97
R4135:Nlrp5 UTSW 7 23,117,823 (GRCm39) missense possibly damaging 0.92
R4609:Nlrp5 UTSW 7 23,117,173 (GRCm39) missense probably benign 0.01
R4649:Nlrp5 UTSW 7 23,117,603 (GRCm39) missense probably damaging 1.00
R4780:Nlrp5 UTSW 7 23,135,203 (GRCm39) missense probably damaging 1.00
R4793:Nlrp5 UTSW 7 23,117,055 (GRCm39) missense probably damaging 0.97
R5062:Nlrp5 UTSW 7 23,135,335 (GRCm39) nonsense probably null
R5224:Nlrp5 UTSW 7 23,117,401 (GRCm39) missense probably damaging 1.00
R5364:Nlrp5 UTSW 7 23,117,753 (GRCm39) nonsense probably null
R5426:Nlrp5 UTSW 7 23,117,626 (GRCm39) missense probably damaging 1.00
R5488:Nlrp5 UTSW 7 23,117,359 (GRCm39) missense probably benign 0.03
R5762:Nlrp5 UTSW 7 23,118,264 (GRCm39) missense possibly damaging 0.89
R6014:Nlrp5 UTSW 7 23,109,372 (GRCm39) missense probably benign 0.02
R6130:Nlrp5 UTSW 7 23,103,598 (GRCm39) missense probably benign 0.00
R6277:Nlrp5 UTSW 7 23,120,880 (GRCm39) missense probably damaging 1.00
R6509:Nlrp5 UTSW 7 23,117,341 (GRCm39) missense probably damaging 1.00
R6519:Nlrp5 UTSW 7 23,117,343 (GRCm39) missense probably benign 0.22
R7042:Nlrp5 UTSW 7 23,116,905 (GRCm39) missense possibly damaging 0.52
R7253:Nlrp5 UTSW 7 23,116,816 (GRCm39) missense possibly damaging 0.93
R7336:Nlrp5 UTSW 7 23,117,059 (GRCm39) missense probably damaging 0.98
R7371:Nlrp5 UTSW 7 23,117,848 (GRCm39) missense probably damaging 0.99
R7449:Nlrp5 UTSW 7 23,116,951 (GRCm39) missense probably benign 0.00
R7505:Nlrp5 UTSW 7 23,106,925 (GRCm39) missense probably benign 0.01
R7580:Nlrp5 UTSW 7 23,133,174 (GRCm39) missense probably damaging 1.00
R7588:Nlrp5 UTSW 7 23,107,576 (GRCm39) missense probably benign 0.21
R7793:Nlrp5 UTSW 7 23,123,343 (GRCm39) missense possibly damaging 0.87
R7795:Nlrp5 UTSW 7 23,118,219 (GRCm39) missense possibly damaging 0.78
R7893:Nlrp5 UTSW 7 23,117,590 (GRCm39) missense probably benign 0.12
R8071:Nlrp5 UTSW 7 23,117,869 (GRCm39) missense probably damaging 1.00
R8170:Nlrp5 UTSW 7 23,133,135 (GRCm39) missense probably benign 0.17
R8195:Nlrp5 UTSW 7 23,112,762 (GRCm39) missense probably benign 0.00
R8212:Nlrp5 UTSW 7 23,116,762 (GRCm39) missense probably benign 0.02
R8232:Nlrp5 UTSW 7 23,116,770 (GRCm39) missense probably benign 0.00
R8743:Nlrp5 UTSW 7 23,118,172 (GRCm39) missense probably benign 0.28
R8853:Nlrp5 UTSW 7 23,117,725 (GRCm39) missense possibly damaging 0.94
R9030:Nlrp5 UTSW 7 23,129,573 (GRCm39) missense possibly damaging 0.65
R9225:Nlrp5 UTSW 7 23,117,371 (GRCm39) missense probably benign 0.24
R9463:Nlrp5 UTSW 7 23,118,225 (GRCm39) missense probably benign 0.24
R9615:Nlrp5 UTSW 7 23,107,561 (GRCm39) missense probably benign 0.10
R9647:Nlrp5 UTSW 7 23,107,576 (GRCm39) missense probably benign 0.12
R9664:Nlrp5 UTSW 7 23,118,286 (GRCm39) missense probably benign 0.01
R9744:Nlrp5 UTSW 7 23,120,902 (GRCm39) missense possibly damaging 0.80
RF007:Nlrp5 UTSW 7 23,117,586 (GRCm39) missense probably benign 0.16
U24488:Nlrp5 UTSW 7 23,117,653 (GRCm39) missense possibly damaging 0.94
X0026:Nlrp5 UTSW 7 23,116,923 (GRCm39) nonsense probably null
X0062:Nlrp5 UTSW 7 23,117,415 (GRCm39) nonsense probably null
Z1088:Nlrp5 UTSW 7 23,103,592 (GRCm39) missense possibly damaging 0.82
Predicted Primers
Posted On 2017-02-27