Incidental Mutation 'R0561:Syde1'
ID45884
Institutional Source Beutler Lab
Gene Symbol Syde1
Ensembl Gene ENSMUSG00000032714
Gene Namesynapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms1200008N06Rik, mSYD1A
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78584503-78591964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78589376 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 267 (R267H)
Ref Sequence ENSEMBL: ENSMUSP00000043085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218215] [ENSMUST00000218875] [ENSMUST00000218885]
Predicted Effect probably damaging
Transcript: ENSMUST00000040580
AA Change: R267H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: R267H

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218641
Predicted Effect probably benign
Transcript: ENSMUST00000218875
Predicted Effect probably benign
Transcript: ENSMUST00000218885
Predicted Effect probably benign
Transcript: ENSMUST00000219588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Syde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syde1 APN 10 78585809 missense probably damaging 1.00
IGL01285:Syde1 APN 10 78588887 missense probably damaging 1.00
IGL01529:Syde1 APN 10 78590181 missense probably benign
IGL01869:Syde1 APN 10 78588919 missense possibly damaging 0.93
IGL02098:Syde1 APN 10 78589371 missense probably damaging 1.00
IGL03187:Syde1 APN 10 78589109 missense possibly damaging 0.79
R0014:Syde1 UTSW 10 78590034 missense probably benign
R0605:Syde1 UTSW 10 78589095 unclassified probably benign
R1713:Syde1 UTSW 10 78585696 missense probably damaging 1.00
R1756:Syde1 UTSW 10 78586980 missense probably benign
R4491:Syde1 UTSW 10 78590228 missense probably benign 0.00
R4846:Syde1 UTSW 10 78588897 missense probably damaging 0.99
R5092:Syde1 UTSW 10 78589418 missense probably benign
R5287:Syde1 UTSW 10 78590037 missense probably benign
R5611:Syde1 UTSW 10 78585891 missense probably benign
R5951:Syde1 UTSW 10 78589316 missense possibly damaging 0.87
R5957:Syde1 UTSW 10 78590117 missense probably damaging 1.00
R6169:Syde1 UTSW 10 78586104 missense probably damaging 1.00
R7083:Syde1 UTSW 10 78587069 missense probably benign 0.44
R7150:Syde1 UTSW 10 78586198 nonsense probably null
R7239:Syde1 UTSW 10 78588781 missense probably damaging 1.00
R7799:Syde1 UTSW 10 78589907 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCGAAAGATGGTTGGCAATAGC -3'
(R):5'- GCCTAAGCCTAAGAAGTACTCGCAC -3'

Sequencing Primer
(F):5'- AATAGCACAGTGCCCTGG -3'
(R):5'- TATCACCTGGACAGCAGTGTG -3'
Posted On2013-06-11