Incidental Mutation 'R0561:C4b'
ID45902
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34734417 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1031 (S1031C)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: S1031C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: S1031C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCCAAACTCAGAATCTTCAGCAC -3'
(R):5'- TTTAGCCTCGGAACCCTTGGAGAC -3'

Sequencing Primer
(F):5'- ATGCTAGTCTCTCAGGAGACC -3'
(R):5'- CCTTGGAGACTATGGGTTCTGAAG -3'
Posted On2013-06-11