Incidental Mutation 'Z1088:Serpinb6c'
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6c
SynonymsSpi3C, SPIC, ovalbumin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #Z1088 ()
Quality Score194
Status Not validated
Chromosomal Location33879816-33905708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33893872 bp
Amino Acid Change Phenylalanine to Leucine at position 172 (F172L)
Ref Sequence ENSEMBL: ENSMUSP00000152676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184] [ENSMUST00000222216]
Predicted Effect probably damaging
Transcript: ENSMUST00000110273
AA Change: F172L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: F172L

SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172184
AA Change: F172L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: F172L

SERPIN 14 379 7.5e-170 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222216
AA Change: F172L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.2%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 1505 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik T C 6: 32,058,492 W36R probably damaging Het
1700016H13Rik G A 5: 103,649,568 P25L probably damaging Het
1700017N19Rik A T 10: 100,605,639 K170M probably damaging Het
1700020A23Rik C T 2: 130,405,852 P77L probably damaging Het
1700020L24Rik A G 11: 83,440,506 Q81R probably damaging Het
2210408I21Rik A C 13: 77,174,891 D13A probably damaging Het
2310003L06Rik G T 5: 87,972,306 Q307H probably damaging Het
2410141K09Rik A C 13: 66,431,186 C413G probably damaging Het
2410141K09Rik C T 13: 66,431,741 G228S probably benign Het
2510039O18Rik G A 4: 147,944,745 E391K probably benign Het
4833423E24Rik T G 2: 85,484,181 K476T probably damaging Het
4833423E24Rik C A 2: 85,502,077 S201I probably benign Het
4930415L06Rik T G X: 89,930,236 D785A unknown Het
4930415L06Rik C A X: 89,930,237 D785Y unknown Het
4930447C04Rik G C 12: 72,939,395 probably benign Het
4931440F15Rik C G 11: 29,825,007 G150A probably damaging Het
4932438A13Rik A C 3: 36,987,567 E2698A probably damaging Het
4932438H23Rik T A 16: 91,055,813 H145L probably benign Het
4933405L10Rik G A 8: 105,709,763 G197E probably damaging Het
5430419D17Rik T C 7: 131,246,633 C839R probably damaging Het
9130011E15Rik T C 19: 45,818,905 E684G probably damaging Het
9430007A20Rik C A 4: 144,528,669 L220M probably damaging Het
A4gnt C T 9: 99,613,841 S110L probably damaging Het
A530099J19Rik C T 13: 19,729,209 noncoding transcript Het
Aasdh T C 5: 76,901,157 probably null Het
Abca13 A C 11: 9,294,687 Q2183H probably damaging Het
Abca14 T A 7: 120,216,135 I202N probably benign Het
Abca17 T A 17: 24,279,079 K1428M probably damaging Het
Abca17 G T 17: 24,279,107 P1419T probably benign Het
Abca17 C G 17: 24,346,219 A80P probably damaging Het
Abca8b A T 11: 109,976,482 M250K probably benign Het
Abcc1 C A 16: 14,410,809 H307N probably benign Het
Abcc12 G A 8: 86,560,279 probably null Het
Abcc8 A G 7: 46,138,065 F571L probably benign Het
Abhd8 G A 8: 71,461,801 P61L probably benign Het
Acan G T 7: 79,088,200 E218* probably null Het
Acan G C 7: 79,100,110 S1543T probably benign Het
Acan A C 7: 79,111,354 H1938P probably benign Het
Accsl A C 2: 93,865,948 F106V probably benign Het
Acnat1 T G 4: 49,447,588 K313T probably damaging Het
Acot8 T C 2: 164,799,813 Q133R probably damaging Het
Acox3 A T 5: 35,588,222 K18M probably damaging Het
Acoxl A C 2: 127,872,195 D137A probably damaging Het
Acsm5 A T 7: 119,537,211 K335M probably damaging Het
Actn4 A C 7: 28,894,578 F855V probably damaging Het
Acvr2a T C 2: 48,870,373 V47A probably benign Het
Ada C G 2: 163,728,116 probably null Het
Adam21 G A 12: 81,560,686 H101Y probably damaging Het
Adam26a T A 8: 43,569,698 N252Y probably damaging Het
Adam26b T C 8: 43,520,597 E456G probably damaging Het
Adam3 C A 8: 24,681,431 probably benign Het
Adamts14 A G 10: 61,218,445 F603L probably damaging Het
Adamts18 T C 8: 113,775,440 K263R possibly damaging Het
Adamts3 G A 5: 89,684,449 R932C probably damaging Het
Adamtsl3 T G 7: 82,499,714 F319V probably damaging Het
Adamtsl3 T C 7: 82,540,325 S586P probably damaging Het
Adcy1 G C 11: 7,150,019 A710P probably benign Het
Adcy4 G A 14: 55,780,956 A178V probably benign Het
Add1 T A 5: 34,613,400 L285* probably null Het
Add2 G C 6: 86,085,965 R35P probably damaging Het
Adgrb3 C T 1: 25,131,271 R982H probably damaging Het
Adgrf3 T G 5: 30,199,120 K378T possibly damaging Het
Adgrl3 C A 5: 81,329,882 H61N probably benign Het
Adgrl3 A T 5: 81,512,158 D258V probably damaging Het
Adgrl4 C A 3: 151,500,175 P175T probably benign Het
Adgrv1 G A 13: 81,476,672 P3726L probably damaging Het
Adra1a T G 14: 66,727,496 F312V probably damaging Het
Aebp1 C T 11: 5,871,460 R620* probably null Het
Afdn G A 17: 13,883,780 S1126N probably damaging Het
Afg3l1 A C 8: 123,488,242 E216D possibly damaging Het
Afp G C 5: 90,505,015 G448A possibly damaging Het
Agap2 G T 10: 127,088,242 S775I unknown Het
Agbl1 T G 7: 76,419,904 F143V probably benign Het
Ahnak A T 19: 9,016,082 N4910I probably damaging Het
AI413582 G A 17: 27,564,241 R51C possibly damaging Het
AI464131 A C 4: 41,497,557 L691R probably benign Het
Ak1 A T 2: 32,630,271 K27M probably damaging Het
Aldh1b1 G C 4: 45,802,539 A26P probably benign Het
Aldh1b1 C T 4: 45,802,540 A26V probably benign Het
Alk C G 17: 72,205,807 G386R probably damaging Het
Amn C T 12: 111,275,683 A368V probably benign Het
Amotl2 TCC TC 9: 102,723,698 probably null Het
Ampd3 T G 7: 110,777,825 L8V probably damaging Het
Anapc2 G T 2: 25,273,368 G206* probably null Het
Angel2 G A 1: 190,937,554 D144N probably damaging Het
Angptl3 A G 4: 99,034,520 N266S probably benign Het
Ank2 A G 3: 127,029,509 V397A possibly damaging Het
Ankib1 T A 5: 3,713,136 E531V probably damaging Het
Ankib1 C A 5: 3,713,137 E531* probably null Het
Ankrd16 CCTCCGGTACTT C 2: 11,779,818 probably null Het
Ankrd24 G A 10: 81,638,656 G74D probably damaging Het
Ankrd44 A C 1: 54,658,982 L606R probably damaging Het
Ankrd50 T G 3: 38,457,165 K351T probably damaging Het
Anks4b G A 7: 120,182,519 D258N probably benign Het
Anln T C 9: 22,362,801 E580G probably benign Het
Ano3 G A 2: 110,745,847 L454F probably damaging Het
Antxrl A T 14: 34,067,971 N340I probably damaging Het
Anxa10 C T 8: 62,092,506 G64D probably damaging Het
Aox1 G A 1: 58,081,542 V865M probably benign Het
Ap3d1 T C 10: 80,719,237 Y418C possibly damaging Het
Ap5b1 A C 19: 5,570,424 K624T possibly damaging Het
Apbb1 C T 7: 105,559,136 C654Y probably damaging Het
Apbb2 T G 5: 66,302,696 K710T probably damaging Het
Apc C T 18: 34,313,167 Q1021* probably null Het
Apcdd1 T G 18: 62,937,183 F174V probably benign Het
Apob C A 12: 8,005,074 L1358I possibly damaging Het
Apob A T 12: 8,005,945 K1476* probably null Het
Apob A G 12: 8,012,936 N193S possibly damaging Het
Apobr G A 7: 126,585,031 R7H probably benign Het
Apol11b A C 15: 77,638,007 I30R probably benign Het
Arfgef2 A T 2: 166,893,595 T1727S possibly damaging Het
Arfip2 G C 7: 105,637,242 L188V probably damaging Het
Arhgap11a A G 2: 113,842,894 C115R probably damaging Het
Arhgap18 A T 10: 26,850,004 probably null Het
Arhgap26 G C 18: 39,357,671 probably benign Het
Arhgap28 G A 17: 67,861,277 A465V possibly damaging Het
Arhgdib C A 6: 136,933,618 K48N probably damaging Het
Arhgef10 C G 8: 14,964,191 A364G probably benign Het
Arhgef10l G C 4: 140,581,735 L17V possibly damaging Het
Arhgef18 C T 8: 3,439,628 S320F probably damaging Het
Arhgef28 G A 13: 97,945,691 R1203W probably damaging Het
Arl5b G A 2: 15,075,021 M134I probably benign Het
Armc1 C A 3: 19,149,507 S85I probably damaging Het
Armc12 A G 17: 28,532,059 E83G probably benign Het
Armc4 G A 18: 7,266,919 S394L probably benign Het
Armh1 C T 4: 117,213,795 D378N probably benign Het
Arsj G T 3: 126,439,132 R509M possibly damaging Het
Arvcf G A 16: 18,402,641 R602H probably damaging Het
Asb14 A G 14: 26,903,348 K220R probably benign Het
Ascc2 C G 11: 4,646,656 A59G probably benign Het
Asf1b G C 8: 83,969,152 A141P possibly damaging Het
Ash1l C A 3: 88,982,709 L632I probably benign Het
Asph T A 4: 9,630,715 N211I possibly damaging Het
Astn1 C A 1: 158,472,497 P136T possibly damaging Het
Astn1 G A 1: 158,597,206 R646H possibly damaging Het
Astn1 C A 1: 158,684,096 Y1169* probably null Het
Asxl3 A C 18: 22,516,772 K606T probably benign Het
Atf7 C G 15: 102,547,182 G249A probably benign Het
Atg14 C G 14: 47,568,292 A39P probably damaging Het
Atg7 T A 6: 114,695,686 F205I probably benign Het
Atm T G 9: 53,531,687 K92T probably damaging Het
Atp11b G T 3: 35,812,213 G387V probably damaging Het
Atp12a G A 14: 56,386,141 V879I probably benign Het
Atp13a5 T G 16: 29,282,062 K681N probably benign Het
Atp2b2 A C 6: 113,842,306 F9V probably damaging Het
Atp6v1h A C 1: 5,098,048 K147T probably damaging Het
Atp8a2 T G 14: 60,027,970 S306R probably benign Het
Atp8b2 T C 3: 89,954,568 K226R probably damaging Het
Atr A G 9: 95,885,320 probably null Het
Atrn G A 2: 130,973,399 S745N probably benign Het
Auts2 T G 5: 131,476,554 probably benign Het
Avpr1a G C 10: 122,449,577 S258T probably benign Het
AW551984 C A 9: 39,590,603 E736* probably null Het
B3galt6 C A 4: 155,991,934 R228L probably benign Het
B3gnt3 G A 8: 71,693,765 S40F possibly damaging Het
B3gnt8 C T 7: 25,628,150 R2C probably damaging Het
Barx2 G A 9: 31,846,866 P259S possibly damaging Het
Baz2b T A 2: 59,960,015 E618V probably damaging Het
BC016579 C T 16: 45,653,948 D32N probably benign Het
BC051665 T G 13: 60,784,643 E76A probably benign Het
Bcl9 G T 3: 97,210,641 Q246K possibly damaging Het
Best3 C T 10: 117,024,170 S445L probably benign Het
Bfar C T 16: 13,697,460 P304L probably damaging Het
Birc6 A C 17: 74,611,542 E1932D probably damaging Het
Bod1l C G 5: 41,808,764 V2653L possibly damaging Het
Bod1l C T 5: 41,821,146 E942K probably damaging Het
Bptf A C 11: 107,074,582 V1147G probably benign Het
Braf A G 6: 39,662,026 C264R probably damaging Het
Brca2 A T 5: 150,542,763 K1997N probably damaging Het
Brf2 T G 8: 27,123,991 E389A probably damaging Het
Brinp2 G A 1: 158,246,989 R521* probably null Het
Brsk1 C T 7: 4,707,372 T460M possibly damaging Het
Brwd3 A T X: 108,774,860 V732E probably damaging Het
Btaf1 T A 19: 36,986,618 V863D probably damaging Het
Btbd11 C T 10: 85,387,857 H177Y probably benign Het
C1rl C A 6: 124,508,742 D357E probably benign Het
C77080 C T 4: 129,222,298 A903T probably damaging Het
Cacna1b T A 2: 24,661,844 K1096M probably damaging Het
Cacna1b T A 2: 24,733,945 S208C probably damaging Het
Cacna1f C G X: 7,610,251 L144V probably damaging Het
Cacna2d1 A C 5: 16,194,763 E121D probably benign Het
Cacna2d3 G T 14: 29,064,308 A574D probably damaging Het
Cadps C A 14: 12,467,113 D935Y probably damaging Het
Camk2a T G 18: 60,943,150 probably benign Het
Capn15 C T 17: 25,963,347 E530K probably damaging Het
Carmil1 G A 13: 24,044,182 Q600* probably null Het
Carmil3 C T 14: 55,501,568 T893M probably damaging Het
Casp12 C T 9: 5,354,582 A317V possibly damaging Het
Casp9 T G 4: 141,805,461 L223V probably benign Het
Casz1 T C 4: 148,944,359 L1087P probably benign Het
Catsper3 T G 13: 55,808,104 F328V probably damaging Het
Cavin1 T C 11: 100,958,658 D382G probably damaging Het
Ccdc116 C A 16: 17,147,171 probably benign Het
Ccdc130 G A 8: 84,258,909 R244* probably null Het
Ccdc14 G A 16: 34,690,804 M1I probably null Het
Ccdc141 T G 2: 77,128,272 E161D probably benign Het
Ccdc175 G T 12: 72,128,379 H507N probably benign Het
Ccdc24 C T 4: 117,871,063 probably null Het
Ccdc83 T C 7: 90,244,046 K168E probably damaging Het
Ccdc87 A G 19: 4,840,722 K414R probably benign Het
Ccr1l1 T G 9: 123,977,850 I187L probably benign Het
Cd209a G T 8: 3,747,017 S80Y probably damaging Het
Cd2ap G A 17: 42,807,993 T518I probably benign Het
Cd300lb A C 11: 114,926,034 L61V probably damaging Het
Cd36 T A 5: 17,795,575 probably null Het
Cd40 A T 2: 165,063,040 K92M probably damaging Het
Cd48 A T 1: 171,695,727 D46V possibly damaging Het
Cd55 T G 1: 130,452,479 D254A probably benign Het
Cd59b G C 2: 104,081,003 S23T possibly damaging Het
Cd8a T C 6: 71,373,686 L45P possibly damaging Het
Cd93 T A 2: 148,442,364 D354V probably benign Het
Cd99l2 G T X: 71,441,088 P63Q probably damaging Het
Cd99l2 C T X: 71,441,146 probably null Het
Cdan1 T C 2: 120,730,336 S251G probably damaging Het
Cdca2 G C 14: 67,700,298 T302S probably benign Het
Cdca7l A G 12: 117,872,411 M206V possibly damaging Het
Cdh22 T C 2: 165,112,430 S724G probably benign Het
Cdh23 T C 10: 60,413,644 T832A probably benign Het
Cdh7 C G 1: 110,085,123 I395M probably benign Het
Cdh8 G T 8: 99,279,502 S151Y probably damaging Het
Cdk11b G T 4: 155,641,564 probably benign Het
Cdkal1 G C 13: 29,777,236 H117D probably damaging Het
Cdr1 T G X: 61,184,104 E485D possibly damaging Het
Celf4 G C 18: 25,496,249 P406A probably benign Het
Celf5 C T 10: 81,466,949 A301T probably damaging Het
Celsr2 T A 3: 108,414,117 S460C probably damaging Het
Cenpf A C 1: 189,652,931 L2384R probably damaging Het
Cenpp T C 13: 49,647,658 probably null Het
Ces1a T G 8: 93,025,607 K374T probably benign Het
Ces1b T C 8: 93,064,966 E335G probably damaging Het
Ces1d T C 8: 93,175,108 K411R probably benign Het
Ces1e T C 8: 93,210,418 T342A probably benign Het
Ces2e A C 8: 104,931,347 K359T probably benign Het
Ces2e A G 8: 104,932,398 probably null Het
Cfap44 G T 16: 44,401,466 R14I probably damaging Het
Cfap46 C T 7: 139,635,064 G1582R probably damaging Het
Cfap57 C T 4: 118,581,882 D816N probably benign Het
Cfap61 C T 2: 146,129,227 P919L probably benign Het
Cfh A G 1: 140,108,904 L636P probably benign Het
Cfh G A 1: 140,147,718 P243S possibly damaging Het
Chd6 T C 2: 160,966,488 D1602G probably damaging Het
Chil1 A G 1: 134,189,500 K345R probably benign Het
Chrd T C 16: 20,741,255 F891L probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cilp2 C G 8: 69,885,410 K190N possibly damaging Het
Cit A T 5: 115,985,533 S1421C possibly damaging Het
Clca3a1 T G 3: 144,746,953 S590R probably damaging Het
Clcn1 C A 6: 42,300,360 L462I probably benign Het
Clcn1 A C 6: 42,307,256 K514T probably damaging Het
Cldn4 G A 5: 134,946,598 L50F probably damaging Het
Clec4g A C 8: 3,707,796 probably benign Het
Clec4g T G 8: 3,716,548 N251T probably damaging Het
Clu A C 14: 65,976,913 E278D probably benign Het
Cmya5 C G 13: 93,063,579 A3414P probably benign Het
CN725425 T G 15: 91,245,762 F276C possibly damaging Het
Cnksr2 T G X: 157,853,220 N854T probably benign Het
Cnot7 ATTTATTTTTTA ATTTA 8: 40,500,739 probably benign Het
Cnst G C 1: 179,579,565 G59A probably damaging Het
Cntn3 A G 6: 102,420,294 L106P possibly damaging Het
Cntnap4 C G 8: 112,815,520 P762A probably damaging Het
Cntnap5a G A 1: 116,060,251 A171T probably benign Het
Col17a1 A G 19: 47,652,178 S994P possibly damaging Het
Col19a1 A C 1: 24,279,940 I1023S probably damaging Het
Col4a1 T G 8: 11,246,859 probably benign Het
Col4a4 A C 1: 82,453,196 L1662V unknown Het
Col6a1 C G 10: 76,709,559 *1026Y probably null Het
Col6a5 A C 9: 105,926,067 I1233S unknown Het
Col7a1 C T 9: 108,978,500 silent Het
Colec12 A G 18: 9,848,727 T302A probably benign Het
Commd4 T C 9: 57,156,256 S73G probably benign Het
Coro1c A G 5: 113,850,649 probably null Het
Cpd C A 11: 76,801,746 C755F probably damaging Het
Cpsf6 T C 10: 117,356,041 D518G unknown Het
Creb3l4 C T 3: 90,237,751 V365M possibly damaging Het
Crhr2 A G 6: 55,103,216 V126A possibly damaging Het
Crim1 G T 17: 78,367,835 K824N probably benign Het
Crispld1 A G 1: 17,764,076 T489A probably benign Het
Crybg1 C T 10: 43,997,311 R1267H probably benign Het
Cryzl2 G T 1: 157,465,789 L153F probably benign Het
Csgalnact1 T C 8: 68,401,330 K273R probably damaging Het
Csmd1 G T 8: 15,921,875 T2985N possibly damaging Het
Csmd1 C T 8: 16,092,258 D1544N probably damaging Het
Csmd1 T G 8: 16,189,978 K1140T possibly damaging Het
Csmd1 G T 8: 16,200,058 Q969K probably damaging Het
Csmd1 T C 8: 16,346,617 D433G probably damaging Het
Csmd3 G A 15: 47,636,393 L3027F probably damaging Het
Csmd3 G A 15: 47,847,281 P1637S probably damaging Het
Csn2 T G 5: 87,696,009 probably benign Het
Cspg4 C A 9: 56,886,036 L352M probably damaging Het
Cspp1 C G 1: 10,083,546 D393E possibly damaging Het
Ctcfl G A 2: 173,118,344 H149Y probably benign Het
Ctnna3 C T 10: 63,581,978 S165F probably benign Het
Ctnnd2 A C 15: 30,966,813 N970T probably benign Het
Ctr9 T C 7: 111,030,224 L19P probably damaging Het
Ctsd C T 7: 142,376,597 G403S probably damaging Het
Cubn G A 2: 13,294,229 S3211L probably benign Het
Cul3 A G 1: 80,290,091 V177A probably benign Het
Cxcl16 C T 11: 70,455,978 G113E probably damaging Het
Cyfip1 A C 7: 55,875,052 K144T probably damaging Het
Cyp2a12 A G 7: 27,035,420 K422R possibly damaging Het
Cyp2a5 G T 7: 26,841,107 D69Y probably damaging Het
Cyp2b23 C G 7: 26,681,411 A130P probably benign Het
Cyp2c50 C T 19: 40,097,955 A321V possibly damaging Homo
Cyp2c68 C T 19: 39,739,463 A82T probably damaging Het
Cyp2d11 C A 15: 82,390,111 M356I probably damaging Het
Cyp2r1 C T 7: 114,551,974 R370K probably damaging Het
Cyp2t4 G C 7: 27,157,746 G345R probably damaging Het
Cyp3a59 A C 5: 146,098,222 N237H probably benign Het
Cyp4a29 T G 4: 115,248,496 F132V probably benign Het
Cyp4f15 G C 17: 32,692,690 probably null Het
Cyp4f40 G A 17: 32,674,002 probably null Het
D030056L22Rik A T 19: 18,717,315 S145C possibly damaging Het
D230025D16Rik C T 8: 105,231,172 R37C probably damaging Het
D7Ertd443e T G 7: 134,294,982 S154R probably benign Het
Dab1 A C 4: 104,479,232 Q8H probably damaging Het
Dag1 G C 9: 108,208,668 P425A possibly damaging Het
Dapk2 T C 9: 66,246,477 F172L possibly damaging Het
Daw1 A T 1: 83,205,964 K245M probably null Het
Dbnl A T 11: 5,796,797 K176* probably null Het
Dcaf13 C T 15: 39,145,247 R415C probably damaging Het
Dcaf15 A C 8: 84,102,781 W111G probably damaging Het
Dclk1 G T 3: 55,500,105 G235V probably damaging Het
Dclre1c G T 2: 3,438,080 E92D possibly damaging Het
Dda1 C G 8: 71,474,495 A4G probably damaging Het
Ddb1 C A 19: 10,619,230 L438I probably damaging Het
Ddit4l G C 3: 137,626,362 G163A probably benign Het
Ddn T C 15: 98,806,139 E424G possibly damaging Het
Ddx19b T G 8: 111,015,575 K176T probably benign Het
Ddx23 A G 15: 98,647,621 V602A probably benign Het
Ddx59 A C 1: 136,432,451 N401T possibly damaging Het
Def8 A G 8: 123,456,498 R279G probably damaging Het
Defb14 G T 8: 19,195,184 G59V probably damaging Het
Defb8 A C 8: 19,447,541 L18R possibly damaging Het
Defb9 A C 8: 21,881,867 F43L probably benign Het
Dennd1a A G 2: 37,800,692 S799P probably benign Het
Dennd2d C T 3: 106,499,874 R414* probably null Het
Dennd4a G A 9: 64,872,022 A596T probably damaging Het
Dennd5a T G 7: 109,894,747 D1250A possibly damaging Het
Dennd5a T C 7: 109,905,273 K854E probably damaging Het
Dera T G 6: 137,837,118 I99M possibly damaging Het
Desi2 A G 1: 178,187,944 N10S probably benign Het
Dgkg T G 16: 22,469,328 N763T probably damaging Het
Dgkg A T 16: 22,572,686 S341T probably benign Het
Dhh T C 15: 98,894,909 N157D probably benign Het
Dhtkd1 C A 2: 5,911,874 A664S possibly damaging Het
Dhx37 T C 5: 125,416,591 E968G possibly damaging Het
Dhx57 A C 17: 80,251,348 L1061V probably damaging Het
Dip2a T C 10: 76,285,628 K798R probably benign Het
Disp3 G C 4: 148,271,743 A220G possibly damaging Het
Dlg4 G A 11: 70,031,130 R66Q probably damaging Het
Dlg5 G A 14: 24,158,094 P992S probably damaging Het
Dlgap2 C G 8: 14,822,472 A651G probably benign Het
Dlx5 C A 6: 6,879,607 Q153H probably damaging Het
Dmd C T X: 83,878,495 S1457F possibly damaging Het
Dmd A G X: 84,575,760 T2614A probably benign Het
Dmrt2 T G 19: 25,678,642 L535R probably damaging Het
Dmxl1 A G 18: 49,920,965 N2546S probably benign Het
Dnaaf3 G A 7: 4,523,795 R428W probably damaging Het
Dnah1 T G 14: 31,304,811 K752T probably benign Het
Dnah11 G C 12: 117,895,012 T4121R probably damaging Het
Dnah11 C A 12: 117,982,969 A3127S probably damaging Het
Dnah2 A C 11: 69,430,793 L3847R probably damaging Het
Dnah3 T A 7: 120,086,297 D164V probably benign Het
Dnah3 T C 7: 120,010,873 K1769R probably null Het
Dnah5 G A 15: 28,366,357 G2739S probably null Het
Dnah5 A C 15: 28,384,230 D3040A probably damaging Het
Dnah7a A C 1: 53,468,643 Y3090D probably damaging Het
Dnajb12 C A 10: 59,890,054 P54T probably benign Het
Dnajb8 G A 6: 88,222,845 G121D probably benign Het
Dnajc6 G A 4: 101,639,329 V830M probably damaging Het
Dnhd1 C G 7: 105,712,727 T3664S probably benign Het
Dnmbp G A 19: 43,874,984 A453V probably benign Het
Dnmbp G A 19: 43,902,122 P402L probably benign Het
Dock1 A G 7: 134,804,547 Y760C probably damaging Het
Dock10 T C 1: 80,532,347 K1588R probably damaging Het
Dock11 A G X: 36,002,533 K718R probably benign Het
Dock2 G A 11: 34,438,300 T211M probably benign Het
Dock2 A C 11: 34,692,382 L568R probably damaging Het
Dock2 C A 11: 34,695,212 E548* probably null Het
Dock9 C T 14: 121,555,275 V1844M probably damaging Het
Dopey2 C T 16: 93,763,326 T720I probably benign Het
Dpf2 A C 19: 5,902,444 F289V probably damaging Het
Dpy19l2 C T 9: 24,660,824 probably null Het
Dsc2 C T 18: 20,046,304 E236K probably damaging Het
Dscam A C 16: 96,772,561 F734V probably benign Het
Dscc1 A C 15: 55,080,317 S386A possibly damaging Het
Dusp27 A G 1: 166,099,283 L920P probably damaging Het
Dync1h1 GAAA GAA 12: 110,629,917 probably null Het
Dyrk3 A G 1: 131,129,233 L401P probably damaging Het
Ecm1 T C 3: 95,734,876 I466V probably benign Het
Eef2 G C 10: 81,181,889 G795A probably damaging Het
Efcab6 A C 15: 83,955,009 L383R probably damaging Het
Efl1 A C 7: 82,692,850 S489R probably benign Het
Egfl8 C A 17: 34,614,241 G177V probably damaging Het
Ehbp1l1 G C 19: 5,716,287 P399A possibly damaging Het
Ehd2 G C 7: 15,963,466 A139G possibly damaging Het
Eif3j1 T G 2: 122,050,613 F182C probably damaging Het
Eif3k T C 7: 28,974,599 probably null Het
Eif3m A C 2: 105,013,256 L127R probably damaging Het
Elac1 T G 18: 73,739,090 D278A probably benign Het
Ell2 TCTAGGTGGCC TC 13: 75,761,873 probably benign Het
Elmod1 A C 9: 53,919,614 S263A probably benign Het
Eme2 T A 17: 24,894,567 probably null Het
Eml1 T G 12: 108,537,459 F772V possibly damaging Het
Emsy G A 7: 98,600,722 P786L probably damaging Het
Epb41l3 T G 17: 69,253,522 F355V probably damaging Het
Epg5 C G 18: 77,959,139 A591G probably benign Het
Epha4 A C 1: 77,506,662 S237A possibly damaging Het
Epha5 G C 5: 84,237,522 H317D probably benign Het
Ephb1 C T 9: 101,984,145 V607I probably damaging Het
Ephx2 A G 14: 66,107,318 F168L probably benign Het
Eps15l1 T G 8: 72,386,901 N249T probably damaging Het
Ercc6l2 A G 13: 63,853,728 E567G possibly damaging Het
Ermp1 G C 19: 29,612,925 S792R probably damaging Het
Esp8 A G 17: 40,530,045 T66A possibly damaging Het
Esr1 C G 10: 4,712,667 A95G possibly damaging Het
Esrrg A T 1: 188,150,218 E224V probably benign Het
Etaa1 T C 11: 17,946,465 T551A possibly damaging Het
Etv5 C T 16: 22,383,589 E472K probably benign Het
Exoc3l4 G A 12: 111,429,487 D645N probably benign Het
Eya4 T C 10: 23,113,988 Q513R probably damaging Het
F11 C T 8: 45,245,772 G445D possibly damaging Het
F13a1 C T 13: 36,989,012 W131* probably null Het
F13b A C 1: 139,508,202 S249R probably benign Het
F5 A C 1: 164,154,385 K73T probably benign Het
F8 C T X: 75,323,149 probably null Het
Fam117a C G 11: 95,371,524 H151Q possibly damaging Het
Fam186a T C 15: 99,945,994 S790G unknown Het
Fam193a A T 5: 34,420,895 E244D probably benign Het
Fam207a C A 10: 77,490,031 S168I probably damaging Het
Fam71b G A 11: 46,407,723 R618K possibly damaging Het
Fancd2 C G 6: 113,581,422 H1167D probably benign Het
Far2 A C 6: 148,138,658 K29T probably damaging Het
Fat1 A G 8: 45,023,807 I1963M possibly damaging Het
Fat4 C G 3: 38,887,050 L31V possibly damaging Het
Fat4 C G 3: 38,958,492 A2312G probably benign Het
Fbln2 G A 6: 91,233,346 D91N probably damaging Het
Fbn1 C T 2: 125,350,288 D1434N probably damaging Het
Fbxo16 A T 14: 65,293,860 K71M possibly damaging Het
Fbxw21 T C 9: 109,145,537 H305R probably benign Het
Fgd4 T A 16: 16,484,470 K74* probably null Het
Fgfr2 A T 7: 130,169,799 L596H probably damaging Het
Fhl1 T A X: 56,779,491 L10Q probably null Het
Fig4 A C 10: 41,253,731 F498V probably damaging Het
Fign A C 2: 64,096,902 S6R probably benign Het
Filip1l G C 16: 57,513,405 S187T probably damaging Het
Fitm2 C T 2: 163,469,865 E143K probably benign Het
Flnb A C 14: 7,905,871 K1207T probably benign Het
Flnc G A 6: 29,457,151 A2351T probably damaging Het
Flt1 T C 5: 147,681,649 T261A possibly damaging Het
Flt3 C G 5: 147,349,564 probably null Het
Fmn1 A C 2: 113,441,925 probably benign Het
Fmo9 A G 1: 166,673,545 probably null Het
Fn1 A G 1: 71,649,292 I151T probably damaging Het
Fndc1 T G 17: 7,782,479 E139A probably damaging Het
Fndc3b G C 3: 27,465,808 C561W possibly damaging Het
Fndc7 T C 3: 108,883,500 E70G probably damaging Het
Folh1 T G 7: 86,725,954 K575T probably benign Het
Foxc2 G C 8: 121,116,959 W115C possibly damaging Het
Foxc2 G C 8: 121,117,150 R179P probably damaging Het
Foxl1 G A 8: 121,128,772 E271K possibly damaging Het
Foxred2 C T 15: 77,952,003 A385T probably damaging Het
Fpr-rs4 T C 17: 18,021,919 S63P possibly damaging Het
Fpr-rs4 G A 17: 18,022,694 R321K probably benign Het
Fras1 A C 5: 96,743,211 Q2866H probably damaging Het
Fras1 T C 5: 96,758,142 L3135P probably benign Het
Frem1 C T 4: 82,972,267 E974K probably damaging Het
Frem3 A C 8: 80,615,426 Q1449H probably benign Het
Frmd6 A G 12: 70,880,678 Q144R probably benign Het
Frmd7 T G X: 50,896,147 N382T possibly damaging Het
Frmpd1 C T 4: 45,284,080 P967L possibly damaging Het
Frmpd4 G A X: 167,497,840 T348M probably damaging Het
Fryl A C 5: 73,090,709 L1022V probably damaging Het
Fryl A C 5: 73,090,738 L1012R probably damaging Het
Fsd1 T A 17: 55,991,203 L176H probably damaging Het
Fsip2 G C 2: 82,975,448 E704Q probably damaging Het
Fsip2 A C 2: 82,987,653 S4577R possibly damaging Het
Fsip2 A C 2: 82,988,634 K4904Q possibly damaging Het
Fyb G A 15: 6,658,540 V794I probably benign Het
Fzd10 T C 5: 128,601,246 L10P probably damaging Het
Fzd7 G C 1: 59,483,870 G304A probably damaging Het
Gadl1 A T 9: 115,937,270 I37L probably benign Het
Gal3st1 C G 11: 3,997,984 P64A probably benign Het
Gal3st2c A G 1: 94,008,145 H73R probably benign Het
Galnt10 G A 11: 57,721,331 G66R possibly damaging Het
Gbp2 G A 3: 142,630,015 D159N probably benign Het
Gbp4 A T 5: 105,120,997 F430Y probably damaging Het
Gbp9 C A 5: 105,094,125 G189W probably damaging Het
Gclc G A 9: 77,781,367 probably null Het
Gcm2 C A 13: 41,102,792 G494W probably damaging Het
Gcnt2 C A 13: 40,918,639 P253T probably damaging Het
Gdf10 C T 14: 33,932,390 R285C probably damaging Het
Gdpd4 A G 7: 97,966,309 S114G probably damaging Het
Gga1 C A 15: 78,892,021 D421E probably damaging Het
Ggt5 T G 10: 75,608,759 F304V possibly damaging Het
Gja3 A C 14: 57,035,815 L367V possibly damaging Het
Gje1 A C 10: 14,718,124 F9V possibly damaging Het
Glrb T G 3: 80,845,234 K407N possibly damaging Het
Glyat A G 19: 12,648,009 T32A probably benign Het
Gm10324 A G 13: 66,122,394 K458R probably damaging Het
Gm10772 C A 13: 66,227,356 S73I probably benign Het
Gm10784 T G 13: 49,945,143 noncoding transcript Het
Gm1110 A C 9: 26,913,310 L145V probably benign Het
Gm11559 C A 11: 99,864,949 C141* probably null Het
Gm11639 A C 11: 104,751,902 K1117T probably damaging Het
Gm12800 A C 4: 101,910,186 I211L probably benign Het
Gm12800 A G 4: 101,909,118 probably null Het
Gm13078 T C 4: 143,727,033 L237P probably damaging Het
Gm13083 C A 4: 143,615,232 A77E possibly damaging Het
Gm13089 T G 4: 143,698,080 Q264H probably benign Het
Gm13101 C T 4: 143,965,562 E290K probably benign Het
Gm13741 A T 2: 87,656,421 S167T probably damaging Het
Gm13741 A C 2: 87,656,877 L15V probably benign Het
Gm15127 A G X: 148,695,496 T415A probably benign Het
Gm156 T C 6: 129,772,463 probably null Het
Gm15932 G C 14: 55,575,840 probably benign Het
Gm1818 C A 12: 48,556,124 noncoding transcript Het
Gm19965 T G 1: 116,804,600 F58V probably benign Het
Gm2016 A C 12: 87,876,934 E117A possibly damaging Het
Gm20939 T C 17: 94,877,433 F503S probably damaging Het
Gm21834 T G 17: 57,742,121 E33D possibly damaging Het
Gm266 C G 12: 111,485,172 G200A probably damaging Het
Gm266 T C 12: 111,485,337 E145G probably damaging Het
Gm364 A C X: 57,488,638 I668L probably benign Het
Gm4775 C G 14: 106,100,965 noncoding transcript Het
Gm4788 T A 1: 139,754,261 Q199L probably damaging Het
Gm4884 A G 7: 41,042,876 N90D possibly damaging Het
Gm4981 T G 10: 58,235,911 E160D probably damaging Het
Gm5114 T C 7: 39,408,447 K583E probably damaging Het
Gm5152 T C 5: 10,243,130 probably benign Het
Gm5565 G A 5: 146,158,669 T172I probably benign Het
Gm6205 C A 5: 94,683,833 A233E probably benign Het
Gm7173 C A X: 79,330,813 L2544F probably damaging Het
Gm7173 A T X: 79,330,814 L2544* probably null Het
Gm8267 T C 14: 44,724,865 K33E probably benign Het
Gm8674 C A 13: 49,900,794 noncoding transcript Het
Gm8674 T C 13: 49,901,248 noncoding transcript Het
Gm904 A C 13: 50,645,262 K86Q probably damaging Het
Gm9637 A G 14: 19,401,731 noncoding transcript Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gm9774 A G 3: 92,429,090 S102P probably damaging Het
Gm9805 A G 17: 22,689,871 Y34C probably benign Het
Gm9964 T C 11: 79,296,408 E71G unknown Het
Gnal G A 18: 67,191,403 D210N probably damaging Het
Gnas A G 2: 174,298,373 S112G probably benign Het
Gnat3 A C 5: 18,015,323 S228R probably damaging Het
Golgb1 A C 16: 36,919,742 E2814D probably damaging Het
Gorab C G 1: 163,386,323 S346T possibly damaging Het
Gorab C A 1: 163,403,550 E12* probably null Het
Gpaa1 A G 15: 76,332,542 E142G possibly damaging Het
Gpatch8 T A 11: 102,480,945 K589I unknown Het
Gphb5 A C 12: 75,415,807 L3V unknown Het
Gpr26 AC A 7: 131,984,094 probably null Het
Gpr75 T G 11: 30,891,139 L15V probably benign Het
Gprasp1 G T X: 135,799,441 A128S possibly damaging Het
Gpsm2 T C 3: 108,700,760 E234G probably damaging Het
Grid1 G A 14: 35,452,294 R631H probably damaging Het
Grm3 A C 5: 9,570,183 F354V probably damaging Het
Grpel1 C T 5: 36,470,614 R80C probably damaging Het
Gsdmd T G 15: 75,863,474 D22E probably benign Het
Gtf2f2 C T 14: 75,897,623 G221S probably damaging Het
Guca1a T C 17: 47,400,410 I4V probably benign Het
Gucy2c G A 6: 136,743,981 P406L probably benign Het
Gykl1 T A 18: 52,694,165 Y148* probably null Het
H2-T22 G A 17: 36,041,638 R132W probably benign Het
Hao2 A C 3: 98,875,352 V340G probably damaging Het
Hapln1 A G 13: 89,601,498 H54R probably benign Het
Haus6 A C 4: 86,602,874 L176V possibly damaging Het
Hc T G 2: 35,008,249 T1145P possibly damaging Het
Hc T A 2: 35,029,470 D668V probably benign Het
Hccs C G X: 169,313,612 R199T probably damaging Het
Hdac9 T G 12: 34,407,789 K255T probably damaging Het
Hdlbp G A 1: 93,431,354 probably benign Het
Heatr5a G A 12: 51,891,404 A1497V probably damaging Het
Heatr5a T C 12: 51,951,076 T347A probably benign Het
Hectd4 A T 5: 121,295,503 probably null Het
Heph T A X: 96,466,031 V130D probably damaging Het
Hephl1 A T 9: 15,053,721 L1126H probably damaging Het
Herc2 G A 7: 56,131,292 G1235D probably benign Het
Herc2 T G 7: 56,215,381 V4202G possibly damaging Het
Herc2 C A 7: 56,215,432 A4219D probably damaging Het
Herc2 G T 7: 56,226,589 C4450F probably damaging Het
Herc2 G A 7: 56,087,341 A183T probably benign Het
Heyl GGAAGAAG GGAAG 4: 123,240,181 probably benign Het
Hgf C T 5: 16,618,919 R705C probably damaging Het
Hip1r A T 5: 123,999,132 probably null Het
Hipk1 T C 3: 103,764,544 E413G possibly damaging Het
Hipk3 G A 2: 104,434,629 S702F probably damaging Het
Hmcn1 G T 1: 150,648,937 A3414D probably damaging Het
Hmcn2 G T 2: 31,381,067 E1252D probably benign Het
Hmcn2 C A 2: 31,459,064 probably null Het
Hmg20b C G 10: 81,346,573 A310P probably damaging Het
Hnrnpab T G 11: 51,601,746 probably benign Het
Hoxa6 G C 6: 52,206,545 F173L possibly damaging Het
Hoxc4 A T 15: 103,034,763 D14V probably damaging Het
Hpdl G C 4: 116,820,833 P144A probably damaging Het
Hsd3b6 T G 3: 98,806,332 K217T probably benign Het
Hsf2 A T 10: 57,496,168 K72N probably damaging Het
Hsf3 G T X: 96,320,316 S193* probably null Het
Hsf3 A T X: 96,320,317 S250T possibly damaging Het
Hspa13 C T 16: 75,758,185 G338S probably benign Het
Hspa4l C G 3: 40,766,993 S282* probably null Het
Hydin A G 8: 110,299,973 K108E probably benign Het
Hydin G T 8: 110,586,048 K4140N probably benign Het
Hydin AGGG AGG 8: 110,592,791 probably null Het
I830077J02Rik C A 3: 105,927,213 A42S probably damaging Het
Iars G A 13: 49,721,088 S746N probably benign Het
Ifi203 A T 1: 173,928,581 probably benign Het
Ifi206 T G 1: 173,474,011 E700D probably damaging Het
Ifi209 A C 1: 173,637,407 K34N probably damaging Het
Ifi209 A G 1: 173,641,146 K181E probably benign Het
Ifi211 A T 1: 173,907,660 F68I possibly damaging Het
Ifna16 C A 4: 88,676,378 S160I probably damaging Het
Ift52 A C 2: 163,023,358 D43A possibly damaging Het
Ighv13-2 G T 12: 114,357,815 Y82* probably null Het
Ighv1-37 A T 12: 114,896,624 probably benign Het
Ighv15-2 T G 12: 114,564,804 D43A probably damaging Het
Ighv1-69 A C 12: 115,623,253 S87A probably benign Het
Ighv5-9-1 C G 12: 113,736,120 C124S probably damaging Het
Ighv7-4 A C 12: 114,222,897 V85G probably damaging Het
Igkv12-98 C A 6: 68,571,031 T48N probably benign Het
Igkv18-36 C A 6: 69,992,499 V104F probably damaging Het
Igkv2-112 G A 6: 68,220,647 S101N possibly damaging Het
Igkv5-48 C A 6: 69,726,691 G77W probably damaging Het
Igsf10 C T 3: 59,329,938 V941I possibly damaging Het
Ik C T 18: 36,744,782 R4* probably null Het
Il11 G A 7: 4,775,999 S44F probably damaging Het
Il18r1 A C 1: 40,474,751 K39T probably damaging Het
Il18r1 C A 1: 40,478,486 S136Y probably damaging Het
Il3ra G A 14: 14,351,129 R217Q probably benign Het
Inpp4b G A 8: 82,068,931 probably null Het
Inpp5f C G 7: 128,694,949 T381R probably benign Het
Insm2 C G 12: 55,599,797 P109A probably damaging Het
Ints11 G A 4: 155,886,970 D292N probably benign Het
Ipo13 T C 4: 117,904,680 E441G probably benign Het
Iqub C T 6: 24,500,243 probably null Het
Itga2 G A 13: 114,857,332 P762S possibly damaging Het
Itga7 T A 10: 128,949,163 I787N probably benign Het
Itgb1 T G 8: 128,713,369 F180V probably damaging Het
Itgb6 C T 2: 60,620,211 R628Q probably null Het
Itk A C 11: 46,353,862 probably null Het
Itpr3 C T 17: 27,113,528 S1782L possibly damaging Het
Itsn2 A C 12: 4,712,472 S1578R probably damaging Het
Izumo3 C T 4: 92,146,933 A16T probably damaging Het
Jag1 C A 2: 137,085,151 W896L probably benign Het
Jakmip1 A T 5: 37,120,986 I536F probably damaging Het
Jmjd1c T C 10: 67,238,174 L1896P probably benign Het
Jmy T A 13: 93,441,081 S860C probably damaging Het
Jph2 G C 2: 163,397,332 S65R possibly damaging Het
Jrk T C 15: 74,707,394 K14R unknown Het
Kat6a C T 8: 22,935,501 R1021* probably null Het
Kbtbd11 C G 8: 15,027,839 P146R probably damaging Het
Kcna3 C A 3: 107,036,953 F177L probably damaging Het
Kcna7 T G 7: 45,406,959 F200V probably benign Het
Kcna7 A T 7: 45,409,105 K272M probably damaging Het
Kcnb1 G C 2: 167,188,061 A188G probably benign Het
Kcnb2 A C 1: 15,710,091 I396L probably benign Het
Kcnb2 C T 1: 15,711,028 S708L probably benign Het
Kcnh5 C T 12: 74,897,761 A905T probably benign Het
Kcnh5 A C 12: 74,965,295 F617V possibly damaging Het
Kcnh6 T G 11: 106,009,048 F48V probably damaging Het
Kcnh7 A C 2: 62,736,103 L828R probably damaging Het
Kcnh7 G A 2: 63,184,068 R4C probably damaging Het
Kcnh8 G C 17: 52,725,890 K68N probably damaging Het
Kcnh8 A G 17: 52,978,292 S1097G probably benign Het
Kcnj15 A G 16: 95,296,119 K200R probably damaging Het
Kcnk9 T A 15: 72,546,015 T89S possibly damaging Het
Kcnn3 A T 3: 89,667,130 S650C probably damaging Het
Kcnq5 G A 1: 21,457,529 P440L probably damaging Het
Kcnt2 G T 1: 140,573,646 D917Y probably damaging Het
Kcnt2 G A 1: 140,584,158 W1017* probably null Het
Kctd19 A C 8: 105,385,335 L826R probably benign Het
Kctd2 A G 11: 115,421,987 E115G possibly damaging Het
Khdrbs2 T C 1: 32,244,055 probably benign Het
Khsrp C T 17: 57,024,249 R443Q probably damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kif18b T G 11: 102,908,157 K739N probably benign Het
Kif20b G C 19: 34,950,451 E1038Q probably damaging Het
Kif24 C A 4: 41,395,091 S594I probably damaging Het
Kif27 T G 13: 58,288,033 Q1315H probably benign Het
Klhl22 T G 16: 17,776,543 F179V possibly damaging Het
Klhl26 T G 8: 70,451,799 E426A probably damaging Het
Klhl41 A C 2: 69,674,730 K459T possibly damaging Het
Klk1b1 A C 7: 43,970,401 K128T probably benign Het
Klk1b26 A T 7: 44,015,996 Q109H probably benign Het
Klk1b3 G A 7: 44,200,305 W38* probably null Het
Klk6 T C 7: 43,828,488 S95P probably benign Het
Klk9 G A 7: 43,794,311 G83D probably damaging Het
Klra2 A C 6: 131,228,290 L196R probably damaging Het
Kmt2b G T 7: 30,585,251 Q739K probably benign Het
Kprp G A 3: 92,825,057 Q229* probably null Het
Kptn T C 7: 16,123,070 L161P probably damaging Het
Kri1 C A 9: 21,274,122 E639D probably benign Het
Krt32 C T 11: 100,088,216 S4N probably benign Het
Krt36 A T 11: 100,104,189 L186M possibly damaging Het
Krt75 C G 15: 101,573,665 G56A probably benign Het
Krt76 A G 15: 101,890,551 L233P probably damaging Het
Krt78 C T 15: 101,947,331 E682K possibly damaging Het
Krtap6-3 G A 16: 89,084,165 C28Y unknown Het
Ksr1 G C 11: 79,044,879 probably null Het
Ksr2 A C 5: 117,747,402 T764P probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lama1 G A 17: 67,771,082 G1171S probably benign Het
Lama1 G T 17: 67,810,171 G2487V probably damaging Het
Large1 C T 8: 72,912,103 W282* probably null Het
Lce1e A G 3: 92,707,849 C64R unknown Het
Lce1f T C 3: 92,719,254 K32R unknown Het
Lce1i C A 3: 92,777,289 probably null Het
Lefty2 A T 1: 180,897,715 R337W probably damaging Het
Lelp1 T A 3: 92,135,598 K48M unknown Het
Lenep C G 3: 89,402,569 G24A probably damaging Het
Lgr6 C T 1: 134,988,071 G313E possibly damaging Het
Lhb A C 7: 45,421,730 probably null Het
Lipo2 T C 19: 33,721,685 Y315C probably damaging Het
Lmbr1 C A 5: 29,323,816 A110S probably damaging Het
Lmtk2 A G 5: 144,182,851 S1377G probably benign Het
Lpcat2b C T 5: 107,433,311 P169S probably damaging Het
Lpin3 T C 2: 160,892,231 F12S probably damaging Het
Lrfn3 A C 7: 30,360,201 F200V probably damaging Het
Lrif1 G A 3: 106,732,570 D324N probably benign Het
Lrp1 G A 10: 127,584,379 R912C probably damaging Het
Lrp10 A C 14: 54,467,922 T190P probably benign Het
Lrpprc G A 17: 84,731,784 Q923* probably null Het
Lrpprc C T 17: 84,770,500 probably null Het
Lrrc18 C T 14: 33,008,510 A2V probably damaging Het
Lrrc28 T G 7: 67,529,631 K329T possibly damaging Het
Lrrc30 T C 17: 67,631,695 K297E possibly damaging Het
Lrrc32 G A 7: 98,499,060 R349K probably benign Het
Lrrc45 G T 11: 120,720,231 V572F probably damaging Het
Lrrc52 C A 1: 167,466,494 G74V possibly damaging Het
Lrrc63 C T 14: 75,125,990 E234K possibly damaging Het
Lrrfip1 GAAGAACAAGAA GAAGAA 1: 91,115,530 probably benign Het
Lrriq1 T A 10: 103,202,446 N832I probably damaging Het
Lrrk2 T G 15: 91,726,240 V725G probably benign Het
Ltbp4 C T 7: 27,307,792 A1364T probably damaging Het
Luc7l T G 17: 26,267,255 L136R probably damaging Het
Luc7l2 A C 6: 38,603,369 probably benign Het
Lypd8 A C 11: 58,386,730 T113P possibly damaging Het
Lyst A T 13: 13,743,433 Q3359H probably benign Het
Lyzl1 A C 18: 4,181,156 K114T probably damaging Het
Magel2 G T 7: 62,378,977 R543L possibly damaging Het
Mak16 A G 8: 31,166,095 L120P probably damaging Het
Man2b2 C T 5: 36,815,356 D605N possibly damaging Het
Map10 CGGG CGG 8: 125,671,931 probably null Het
Map1b T G 13: 99,508,115 E93D probably benign Het
Map1s T G 8: 70,916,449 F881V possibly damaging Het
Map3k3 G A 11: 106,150,353 D383N possibly damaging Het
Map3k6 C G 4: 133,245,066 H318D probably damaging Het
Mapk13 A G 17: 28,777,533 E245G possibly damaging Het
Mapkapk5 C T 5: 121,531,591 E115K probably benign Het
March10 C A 11: 105,390,359 G367W probably damaging Het
Marveld3 G A 8: 109,948,063 R374C possibly damaging Het
Mast4 T G 13: 102,738,519 K1255T probably damaging Het
Maz GGCCCTG GG 7: 127,024,474 probably null Het
Mcf2 T C X: 60,178,713 H65R probably benign Het
Mcm6 T G 1: 128,344,298 N454T probably damaging Het
Mcpt4 T A 14: 56,060,510 R195* probably null Het
Mdm1 A C 10: 118,158,362 K380N possibly damaging Het
Mdm4 A G 1: 132,994,547 S286P probably benign Het
Med13l C A 5: 118,749,641 T1660K probably damaging Het
Med14 A C X: 12,677,606 L1451R probably damaging Het
Megf11 A T 9: 64,660,476 S416C probably damaging Het
Megf8 G A 7: 25,339,669 E902K possibly damaging Het
Mep1a C G 17: 43,491,596 W192C probably damaging Het
Mfap3 T A 11: 57,528,142 F43I possibly damaging Het
Mfhas1 C G 8: 35,590,236 P622A probably benign Het
Mgam G C 6: 40,643,060 V28L probably benign Het
Mgp T G 6: 136,874,263 probably null Het
Micall2 T A 5: 139,706,894 K908M probably damaging Het
Micall2 A C 5: 139,716,295 L398V probably benign Het
Mill2 G A 7: 18,856,399 probably null Het
Mir1966 C T 8: 105,615,571 R130* probably null Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mkx C T 18: 6,936,975 A319T probably damaging Het
Mn1 T A 5: 111,418,280 F39I possibly damaging Het
Morc2b A T 17: 33,136,086 I904N possibly damaging Het
Mpo T G 11: 87,795,245 F74V probably benign Het
Mpv17l2 T G 8: 70,759,410 K139T probably damaging Het
Mrgprb4 A G 7: 48,198,682 L166P possibly damaging Het
Mrgprg C G 7: 143,764,656 A240P probably damaging Het
Mrgprx1 T G 7: 48,021,129 K290T probably damaging Het
Mroh5 G A 15: 73,788,031 A320V possibly damaging Het
Mrpl1 T G 5: 96,262,069 M267R probably damaging Het
Mrpl2 A G 17: 46,647,478 K62R probably null Het
Mrps36 T G 13: 100,739,133 S58R possibly damaging Het
Msantd3 A C 4: 48,552,525 D38A probably damaging Het
Mta1 C T 12: 113,133,200 P547L probably benign Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Mtcl1 C T 17: 66,343,728 A1132T probably benign Het
Mtf2 A G 5: 108,087,329 D139G probably damaging Het
Mthfd1l T G 10: 4,007,844 F294V probably benign Het
Mtus2 G A 5: 148,303,263 probably benign Het
Muc4 A T 16: 32,756,076 probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Muc5ac A C 7: 141,811,692 T1984P possibly damaging Het
Muc5b A G 7: 141,862,214 S2966G probably benign Het
Mup3 G C 4: 62,087,189 L15V unknown Het
Mvd G C 8: 122,439,730 A56G probably benign Het
Mvk G T 5: 114,458,934 G321W probably damaging Het
Mxra7 G T 11: 116,804,606 N157K probably benign Het
Mybpc2 T C 7: 44,516,503 K256R possibly damaging Het
Mybpc3 A G 2: 91,135,359 E1172G probably benign Het
Myh11 AGG AG 16: 14,269,262 probably null Het
Myh2 GTATTTATTTA GTATTTA 11: 67,180,763 probably benign Het
Myh2 C T 11: 67,191,449 L1326F probably damaging Het
Myh6 C T 14: 54,956,997 R725H probably damaging Het
Myh8 A C 11: 67,298,592 K1198T probably damaging Het
Myh9 A G 15: 77,775,258 L96P probably damaging Het
Myo18b G A 5: 112,692,943 S2328L possibly damaging Het
Myo18b C T 5: 112,757,484 E2083K probably benign Het
Myo1d T G 11: 80,674,898 N367T probably benign Het
Myo5b G C 18: 74,744,749 E1606D probably benign Het
Myo5c C G 9: 75,245,059 S76R probably damaging Het
Myrf C A 19: 10,221,298 Q195H probably damaging Het
Nacc1 G C 8: 84,673,286 A434G probably damaging Het
Naip2 A T 13: 100,161,909 Y540N probably benign Het
Nap1l2 T G X: 103,185,196 N372T probably damaging Het
Nat8 G T 6: 85,831,193 probably benign Het
Nav1 T C 1: 135,470,724 T707A probably benign Het
Nbea G A 3: 55,723,163 T2251I probably benign Het
Nbeal2 G C 9: 110,632,372 A1536G possibly damaging Het
Ncapg T G 5: 45,679,880 L431R probably damaging Het
Nck2 A C 1: 43,554,383 N250T possibly damaging Het
Nckap5 G A 1: 126,024,832 R1264C possibly damaging Het
Nckipsd G C 9: 108,814,677 K492N probably benign Het
Ncor2 T A 5: 125,067,788 S597C unknown Het
Ncor2 C T 5: 125,086,840 probably null Het
Ndn T G 7: 62,349,134 F243V probably damaging Het
Ndufs6 A G 13: 73,328,436 V4A probably benign Het
Neb C T 2: 52,169,872 V2321I possibly damaging Het
Neb G C 2: 52,223,152 P7A probably benign Het
Neb T A 2: 52,308,567 K423M probably damaging Het
Nedd4 G A 9: 72,670,078 V62M probably benign Het
Nek7 C A 1: 138,515,625 V197L probably null Het
Nelfcd GTT GT 2: 174,426,494 probably null Het
Nell2 A T 15: 95,435,097 L194M probably damaging Het
Neurod6 G A 6: 55,679,362 Q97* probably null Het
Nfkbiz G C 16: 55,816,438 A500G probably damaging Het
Nfkbiz T C 16: 55,818,236 Y287C probably damaging Het
Nfrkb A C 9: 31,411,333 S900R possibly damaging Het
Nipbl T A 15: 8,307,882 E2065D probably damaging Het
Nkapl C G 13: 21,468,303 G47R unknown Het
Nlrc5 A G 8: 94,504,464 D1275G possibly damaging Het
Nlrp12 T C 7: 3,222,537 K1034R probably benign Het
Nlrp14 T G 7: 107,186,622 L635R probably damaging Het
Nlrp3 G C 11: 59,551,860 S746T possibly damaging Het
Nlrp4a T C 7: 26,454,163 V713A probably benign Het
Nlrp4c A C 7: 6,066,636 K512T probably damaging Het
Nlrp4f C T 13: 65,194,302 E510K probably benign Het
Nlrp4g T G 9: 124,349,201 noncoding transcript Het
Nlrp5 G A 7: 23,404,167 E20K possibly damaging Het
Nlrp5 T C 7: 23,417,586 L245P probably damaging Het
Nlrp9b T G 7: 20,023,743 F302V probably benign Het
Nme8 T A 13: 19,688,957 E172D possibly damaging Het
Nnt G A 13: 119,338,446 S649L probably damaging Het
Nod2 G C 8: 88,664,146 Q345H probably damaging Het
Nol4 C T 18: 22,921,902 S157N probably damaging Het
Nolc1 G T 19: 46,083,098 probably benign Het
Notch1 T G 2: 26,477,115 D680A probably damaging Het
Notch3 C G 17: 32,158,652 G150A possibly damaging Het
Notch4 C T 17: 34,587,915 P1942L probably damaging Het
Nr3c2 C A 8: 76,908,632 Q121K possibly damaging Het
Nr4a2 C T 2: 57,111,614 G213S probably damaging Het
Nrg1 G C 8: 31,918,005 L67V possibly damaging Het
Nrxn1 T A 17: 90,059,505 D31V probably damaging Het
Nsd1 A C 13: 55,213,848 S210R possibly damaging Het
Nsd2 T C 5: 33,855,738 probably null Het
Nsd3 CCTTCT CCT 8: 25,641,002 probably benign Het
Nsun2 A T 13: 69,615,465 K103M probably damaging Het
Ntn5 G C 7: 45,694,203 G322A probably damaging Het
Nudt4 C T 10: 95,552,515 G60S probably benign Het
Numa1 T G 7: 101,998,331 L423R probably damaging Het
Numa1 C A 7: 101,998,402 Q447K probably benign Het
Nup214 T C 2: 32,011,223 F940L probably benign Het
Nxpe5 G A 5: 138,240,914 probably null Het
Nxph2 G T 2: 23,400,217 A194S probably benign Het
Oaz1 C G 10: 80,826,829 R24G possibly damaging Het
Obox2 A G 7: 15,397,338 K123R possibly damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Oca2 G T 7: 56,330,375 K609N probably null Het
Ocln G A 13: 100,535,052 R266* probably null Het
Ocstamp C A 2: 165,395,918 Q475H possibly damaging Het
Odf1 A G 15: 38,219,674 Y82C probably benign Het
Ogdh A C 11: 6,355,427 D978A probably benign Het
Olfm3 G T 3: 114,904,668 probably benign Het
Olfm5 T G 7: 104,154,150 S294R probably damaging Het
Olfr1014 T G 2: 85,777,122 D179E probably damaging Het
Olfr1026 T G 2: 85,923,798 F177V probably damaging Het
Olfr103 A C 17: 37,336,705 F176V probably damaging Het
Olfr1033 T C 2: 86,041,719 S135P probably damaging Het
Olfr1036 G T 2: 86,075,323 E194D possibly damaging Het
Olfr1037 C T 2: 86,084,982 S265N probably benign Het
Olfr1047 C A 2: 86,228,222 V250F probably damaging Het
Olfr1056 A T 2: 86,355,893 I163N probably benign Het
Olfr1058 T C 2: 86,385,756 I221V probably benign Het
Olfr1058 T G 2: 86,386,179 K80Q probably damaging Het
Olfr1080 C T 2: 86,553,966 A53T probably benign Het
Olfr1093 A G 2: 86,786,473 K248E probably damaging Het
Olfr1099 T G 2: 86,958,666 K264T probably benign Het
Olfr1106 A C 2: 87,048,433 L268V probably benign Het
Olfr1113 T G 2: 87,213,778 I295M possibly damaging Het
Olfr1116 G T 2: 87,269,575 G265* probably null Het
Olfr1124 A G 2: 87,435,159 Y224C probably damaging Het
Olfr1129 T C 2: 87,575,680 S199P possibly damaging Het
Olfr1140 G T 2: 87,746,489 A98S probably damaging Het
Olfr1145 C A 2: 87,810,746 L309I probably damaging Het
Olfr1153 G A 2: 87,896,633 A145T probably benign Het
Olfr1154 A C 2: 87,903,584 F31V possibly damaging Het
Olfr1155 G A 2: 87,943,448 P60L probably damaging Het
Olfr116 G T 17: 37,624,429 L69M probably damaging Het
Olfr1193 T G 2: 88,678,664 F263V probably damaging Het
Olfr1198 A C 2: 88,746,578 F103L probably damaging Het
Olfr120 T A 17: 37,726,092 F23I probably damaging Het
Olfr1215 C A 2: 89,001,838 G150V possibly damaging Het
Olfr1259 A G 2: 89,943,770 V115A probably benign Het
Olfr1276 T G 2: 111,257,859 V248G possibly damaging Het
Olfr1287 T C 2: 111,449,457 F106L probably benign Het
Olfr1294 A C 2: 111,537,814 I158M possibly damaging Het
Olfr1329 A C 4: 118,916,588 L293R probably damaging Het
Olfr1341 A G 4: 118,710,226 K273R probably benign Het
Olfr1387 T G 11: 49,460,456 L259R probably damaging Het
Olfr1412 T A 1: 92,588,551 S74T probably damaging Het
Olfr1424 T C 19: 12,059,129 T208A probably benign Het
Olfr1431 A C 19: 12,210,490 K308T possibly damaging Het
Olfr1432 C A 19: 12,229,224 W107C probably damaging Het
Olfr1440 A C 19: 12,394,299 K12T probably benign Het
Olfr1444 T C 19: 12,862,284 C170R probably damaging Het
Olfr1453 A C 19: 13,028,027 F101V probably benign Het
Olfr146 A C 9: 39,018,789 F251V probably damaging Het
Olfr1471 T C 19: 13,445,849 V279A possibly damaging Het
Olfr1480 T G 19: 13,529,852 F104V possibly damaging Het
Olfr1489 C A 19: 13,633,453 A114E probably damaging Het
Olfr1495 C A 19: 13,768,416 P25T probably benign Het
Olfr1499 A C 19: 13,815,548 L14R probably damaging Het
Olfr1509 C A 14: 52,451,209 F265L probably benign Het
Olfr152 G T 2: 87,782,628 L29F probably damaging Het
Olfr154 C T 2: 85,663,616 V273I probably benign Het
Olfr16 T A 1: 172,957,324 F176L probably damaging Het
Olfr166 T C 16: 19,487,048 L70P possibly damaging Het
Olfr23 G A 11: 73,941,138 M297I probably benign Het
Olfr231 C T 1: 174,117,315 A234T probably benign Het
Olfr299 T A 7: 86,465,746 F112I possibly damaging Het
Olfr340 T G 2: 36,452,906 F107C possibly damaging Het
Olfr357 A C 2: 36,997,705 K298N possibly damaging Het
Olfr364-ps1 T G 2: 37,146,385 F58V probably benign Het
Olfr373 T G 8: 72,100,517 F252L probably benign Het
Olfr378 T C 11: 73,425,105 S293G probably benign Het
Olfr410 A T 11: 74,334,692 F180I probably damaging Het
Olfr417 G A 1: 174,369,744 V276I probably benign Het
Olfr430 C T 1: 174,069,949 S217F probably damaging Het
Olfr477 G A 7: 107,990,731 R122H probably benign Het
Olfr480 C A 7: 108,066,327 C127F probably damaging Het
Olfr498 T A 7: 108,465,371 F16I probably benign Het
Olfr502 A C 7: 108,523,398 F184C probably damaging Het
Olfr512 T G 7: 108,713,538 F50V probably benign Het
Olfr513 T G 7: 108,755,104 L83V probably benign Het
Olfr514 A C 7: 108,825,896 Y34* probably null Het
Olfr519 G T 7: 108,893,773 F211L probably damaging Het
Olfr536 A C 7: 140,503,805 V218G probably benign Het
Olfr59 T C 11: 74,288,835 L63P probably damaging Het
Olfr591 A G 7: 103,172,806 L277P possibly damaging Het
Olfr60 A G 7: 140,345,804 F62L probably benign Het
Olfr61 A G 7: 140,638,220 K173R probably benign Het
Olfr615 A G 7: 103,561,059 K194R probably benign Het
Olfr615 G C 7: 103,561,390 L304F probably damaging Het
Olfr625-ps1 T G 7: 103,683,186 I156S probably benign Het
Olfr643 A C 7: 104,059,316 S95R possibly damaging Het
Olfr663 T C 7: 104,704,493 Y309H probably benign Het
Olfr667 G T 7: 104,916,666 A210E probably benign Het
Olfr67 T G 7: 103,787,365 K304T probably damaging Het
Olfr672 C A 7: 104,996,454 G150V probably benign Het
Olfr693 T G 7: 106,678,457 S10R probably benign Het
Olfr697 A T 7: 106,741,143 S264T probably benign Het
Olfr706 T A 7: 106,886,296 I174F probably damaging Het
Olfr714 C A 7: 107,074,405 D192E possibly damaging Het
Olfr716 A C 7: 107,148,212 S299R probably benign Het
Olfr742 T C 14: 50,515,527 F108L possibly damaging Het
Olfr77 T A 9: 19,920,712 F168I probably damaging Het
Olfr770 T G 10: 129,133,075 K231T probably benign Het
Olfr807 A C 10: 129,755,339 I37S possibly damaging Het
Olfr815 T C 10: 129,902,683 E9G possibly damaging Het
Olfr821 A C 10: 130,033,788 K54T probably damaging Het
Olfr832 G A 9: 18,945,421 V258I possibly damaging Het
Olfr847 G A 9: 19,375,684 L66F probably damaging Het
Olfr866 A G 9: 20,027,279 S220P probably damaging Het
Olfr877 A C 9: 37,855,318 S167R probably benign Het
Olfr888 T C 9: 38,109,586 V295A probably damaging Het
Olfr895 T C 9: 38,268,612 L33S probably damaging Het
Olfr910 T C 9: 38,539,149 F85L probably damaging Het
Olfr911-ps1 T G 9: 38,523,859 N42K probably damaging Het
Olfr945 G A 9: 39,257,871 S270L probably benign Het
Olfr980 A G 9: 40,006,596 S118P probably damaging Het
Omg G C 11: 79,502,320 N237K possibly damaging Het
Oog3 T A 4: 144,158,307 N353I probably benign Het
Oog3 A G 4: 144,159,636 F131L probably benign Het
Orc2 A C 1: 58,476,516 F230V probably benign Het
Osbpl3 A G 6: 50,297,097 F846L probably damaging Het
Pabpc1l G C 2: 164,032,324 probably null Het
Pah C T 10: 87,571,291 S303F probably damaging Het
Paip2b T G 6: 83,808,882 N122T probably benign Het
Pak4 G T 7: 28,565,228 T83N probably damaging Het
Pamr1 C A 2: 102,634,446 F313L possibly damaging Het
Papln C G 12: 83,776,376 P396A probably benign Het
Papss1 C G 3: 131,642,967 H559Q possibly damaging Het
Parp14 C G 16: 35,841,586 D1360H probably damaging Het
Pask C T 1: 93,316,801 S1166N probably damaging Het
Pbk T A 14: 65,813,948 V145D probably damaging Het
Pbrm1 G A 14: 31,110,454 R1443Q possibly damaging Het
Pcbp3 C A 10: 76,763,323 Q326H probably benign Het
Pcdh1 G C 18: 38,198,067 R767G probably damaging Het
Pcdh17 A G 14: 84,448,274 K727R possibly damaging Het
Pcdha2 G T 18: 36,941,121 G602C probably damaging Het
Pcdha6 G A 18: 36,969,217 A488T probably damaging Het
Pcdhac1 G T 18: 37,092,190 L685F probably damaging Het
Pcdhac1 G T 18: 37,092,566 A811S probably damaging Het
Pcdhb21 A G 18: 37,514,541 E241G probably benign Het
Pcdhb22 A C 18: 37,519,345 T289P probably benign Het
Pcdhb6 T A 18: 37,335,146 D373E probably damaging Het
Pcdhga11 G C 18: 37,756,184 G82R probably damaging Het
Pcmtd1 C T 1: 7,163,330 P222L possibly damaging Het
Pcnx2 C T 8: 125,826,928 E1151K probably damaging Het
Pcnx2 T G 8: 125,866,018 S736R probably damaging Het
Pcsk5 A G 19: 17,463,374 L1284P probably damaging Het
Pdgfra C T 5: 75,166,577 S145F probably benign Het
Pdrg1 C T 2: 153,014,037 A46T probably damaging Het
Pds5a A C 5: 65,618,986 I88M probably damaging Het
Pdzk1 A G 3: 96,854,557 N162D probably benign Het
Pelp1 A G 11: 70,396,890 L402P probably damaging Het
Pet2 A G X: 89,406,337 V62A probably benign Het
Pex1 G A 5: 3,606,075 A301T probably benign Het
Pex6 A T 17: 46,712,222 Q241H possibly damaging Het
Pgm3 A G 9: 86,564,707 F253L probably damaging Het
Pi4k2b G A 5: 52,760,931 R367Q possibly damaging Het
Pi4kb T G 3: 94,984,509 F179V probably damaging Het
Pid1 T G 1: 84,116,014 N51T probably benign Het
Piezo2 C T 18: 63,069,994 G1525D probably damaging Het
Piga A C X: 164,422,909 K88N probably damaging Het
Pigo G C 4: 43,019,409 P970A probably damaging Het
Pik3r6 G A 11: 68,525,602 V6M probably damaging Het
Piwil4 G A 9: 14,734,517 H142Y probably damaging Het
Pkd1 T G 17: 24,565,605 L375R probably benign Het
Pkd2 T G 5: 104,498,861 L780V probably damaging Het
Pkdcc A G 17: 83,222,150 E380G probably damaging Het
Pla2g12a C T 3: 129,890,380 S136F probably benign Het
Pla2g2c T C 4: 138,734,286 F22S probably damaging Het
Pla2g4c A T 7: 13,329,753 Q48H probably benign Het
Plb1 T G 5: 32,310,847 F503V probably damaging Het
Plb1 C T 5: 32,310,917 S526L probably benign Het
Plcb1 A C 2: 135,220,846 E27D probably benign Het
Plcl2 C A 17: 50,606,992 P343H probably damaging Het
Pld1 A C 3: 28,029,243 I171L probably benign Het
Plod2 T G 9: 92,603,035 F551V probably benign Het
Plxna2 A C 1: 194,644,441 I228L possibly damaging Het
Plxna2 A G 1: 194,764,539 N786D probably benign Het
Plxnd1 C A 6: 115,967,510 S1033I probably benign Het
Pmfbp1 A C 8: 109,513,944 E219D probably damaging Het
Pml G T 9: 58,234,590 L320M probably damaging Het
Pnisr C G 4: 21,873,684 R476G probably benign Het
Pnliprp2 G A 19: 58,762,325 A149T probably damaging Het
Pnp T G 14: 50,951,495 D248E probably benign Het
Pnpla5 A G 15: 84,123,071 S15P probably damaging Het
Pogz T A 3: 94,879,076 F992I probably damaging Het
Pole C T 5: 110,327,865 L1847F possibly damaging Het
Polr2b T G 5: 77,342,722 I903S possibly damaging Het
Polr2b G A 5: 77,345,401 G1077S probably damaging Het
Polr3a A C 14: 24,479,724 V266G probably damaging Het
Pop1 C G 15: 34,499,319 A10G probably damaging Het
Pop7 T C 5: 137,502,011 Y20C probably damaging Het
Postn A T 3: 54,375,127 D503V probably benign Het
Pou4f2 C G 8: 78,435,601 Q124H probably benign Het
Ppl G A 16: 5,089,507 R975W probably damaging Het
Ppp1cc C T 5: 122,172,753 S182F possibly damaging Het
Ppp1r10 ACATGATGTCCCTAGCCAT ACAT 17: 35,930,767 probably benign Het
Ppp1r7 T C 1: 93,352,588 L126P probably damaging Het
Ppp2r1b A C 9: 50,866,911 E309D probably damaging Het
Prdm1 G A 10: 44,441,925 R301W probably damaging Het
Prg2 G T 2: 84,982,265 K106N possibly damaging Het
Prkg2 A T 5: 99,024,804 H17Q probably benign Het
Prob1 G C 18: 35,652,769 P811A possibly damaging Het
Prox1 G C 1: 190,161,999 A83G probably damaging Het
Prr23a1 G A 9: 98,843,347 R254Q possibly damaging Het
Prr27 G A 5: 87,842,646 R31H probably damaging Het
Prr30 G C 14: 101,198,140 Q329E probably benign Het
Prrc2b C A 2: 32,214,429 N1306K probably benign Het
Prrc2b G A 2: 32,216,732 R1582K probably damaging Het
Prrx1 A C 1: 163,261,877 L127R probably damaging Het
Prss36 G A 7: 127,934,537 R32* probably null Het
Prss53 C T 7: 127,887,398 W352* probably null Het
Psd3 T C 8: 67,906,260 silent Het
Psg17 G A 7: 18,816,910 T340I probably benign Het
Psg25 T A 7: 18,529,591 R102S probably benign Het
Psmd11 A ATC 11: 80,471,550 probably null Het
Ptcra G C 17: 46,763,595 A7G probably damaging Het
Pten C T 19: 32,776,051 A39V probably damaging Het
Pten A C 19: 32,799,998 T131P probably damaging Het
Ptgfrn T G 3: 101,056,437 T620P probably damaging Het
Ptprn T A 1: 75,260,620 M20L possibly damaging Het
Ptprq C T 10: 107,699,672 A411T possibly damaging Het
Ptprt A G 2: 162,238,121 S253P possibly damaging Het
Rab3gap2 A T 1: 185,281,677 L1173F probably damaging Het
Rac1 C A 5: 143,514,719 A59S probably damaging Het
Rad21 T G 15: 51,982,626 K16T probably damaging Het
Rad21l C T 2: 151,668,019 R54Q probably damaging Het
Rad9b A G 5: 122,333,372 F210L possibly damaging Het
Raet1e A C 10: 22,181,951 T206P possibly damaging Het
Ralgapa2 T G 2: 146,434,905 S472R probably benign Het
Ranbp2 GGT GGTTTGTGCTCCGT 10: 58,477,983 probably null Het
Ranbp2 A T 10: 58,492,893 Q2871H probably benign Het
Rapgefl1 C G 11: 98,845,895 P285R probably damaging Het
Rasgrp4 A C 7: 29,150,536 probably benign Het
Rassf7 C G 7: 141,217,145 S90R probably damaging Het
Rassf8 A G 6: 145,815,482 Q178R probably benign Het
Rassf8 A C 6: 145,816,616 E371A probably benign Het
Rb1cc1 AT ATT 1: 6,249,018 probably null Het
Rbm12b1 G T 4: 12,146,079 V684L probably benign Het
Rdh16f1 A C 10: 127,788,833 K180T probably damaging Het
Rec8 A T 14: 55,625,147 K553M probably damaging Het
Reg1 G T 6: 78,426,918 E23* probably null Het
Rergl C A 6: 139,493,426 E135* probably null Het
Resp18 T C 1: 75,278,291 K6R possibly damaging Het
Rev3l C A 10: 39,824,318 Q1604K probably benign Het
Rfc3 C T 5: 151,644,862 R213H probably benign Het
Rfwd3 C A 8: 111,297,606 G28V probably benign Het
Rfx3 G A 19: 27,837,450 S169F probably damaging Het
Rfx8 T G 1: 39,682,966 E286D possibly damaging Het
Rgl1 G A 1: 152,675,020 probably benign Het
Rgs11 G C 17: 26,205,772 Q218H probably benign Het
Rgs7 T C 1: 175,084,020 E345G possibly damaging Het
Rims1 C G 1: 22,288,586 A1258P probably damaging Het
Rint1 A G 5: 23,805,314 N174D probably benign Het
Ripk3 T G 14: 55,787,926 E60D possibly damaging Het
Rnf146 G A 10: 29,347,572 A106V probably damaging Het
Rnf213 A G 11: 119,477,254 K4705R possibly damaging Het
Rnmt C T 18: 68,307,674 S136L probably benign Het
Rp1l1 C T 14: 64,028,758 H598Y possibly damaging Het
Rp1l1 T G 14: 64,030,378 F1138V probably benign Het
Rpgrip1l A T 8: 91,220,179 *1265R probably null Het
Rpgrip1l T G 8: 91,260,975 K818T possibly damaging Het
Rpgrip1l A T 8: 91,270,120 F109I possibly damaging Het
Rpl12 T A 2: 32,963,019 I82N possibly damaging Het
Rpl13a G C 7: 45,127,513 A24G probably damaging Het
Rpp14 A C 14: 8,090,539 E154D probably benign Het
Rps19 G C 7: 24,886,107 probably benign Het
Rptn C A 3: 93,397,427 P689H probably benign Het
Rrbp1 C A 2: 143,974,486 G741V probably damaging Het
Rreb1 G A 13: 37,948,937 R1696K probably benign Het
Rsl1d1 C T 16: 11,202,385 G59R possibly damaging Het
Rtl1 T A 12: 109,592,319 T1029S probably benign Het
Runx1 C T 16: 92,605,792 A421T probably damaging Het
Runx1t1 G A 4: 13,865,892 R380Q possibly damaging Het
Rxfp1 C T 3: 79,705,704 G20R probably damaging Het
Ryr3 C A 2: 112,900,916 G683V probably damaging Het
S100a13 C G 3: 90,515,942 S80C probably damaging Het
Satb1 C G 17: 51,782,939 Q293H probably damaging Het
Satb1 G A 17: 51,782,952 S289F probably damaging Het
Sbno1 T G 5: 124,393,958 K719N possibly damaging Het
Sbno1 G T 5: 124,404,304 P308T probably damaging Het
Sbpl A C 17: 23,953,544 F134V probably damaging Het
Sbsn G T 7: 30,751,751 E64* probably null Het
Scaf8 T G 17: 3,162,983 probably benign Het
Scap A G 9: 110,372,336 N131S probably damaging Het
Scarf1 C T 11: 75,525,490 A586V probably damaging Het
Scd1 C A 19: 44,397,923 S355I probably benign Het
Scgb2b26 A C 7: 33,944,367 F49L probably benign Het
Scn11a A G 9: 119,755,242 F1436L probably damaging Het
Scn7a C T 2: 66,713,951 E399K probably damaging Het
Scrib G A 15: 76,048,231 P1560S probably damaging Het
Sctr GT G 1: 120,036,406 probably null Het
Sec16a G A 2: 26,439,093 S970F probably damaging Het
Sec16b A G 1: 157,558,024 probably null Het
Sec23a A G 12: 59,004,576 F94L probably benign Het
Sel1l3 C A 5: 53,116,196 A1081S probably damaging Het
Selenok G A 14: 29,973,444 G93E probably damaging Het
Selenov G A 7: 28,290,668 T137I possibly damaging Het
Sema3b A C 9: 107,599,034 probably null Het
Sema3e G A 5: 14,226,456 S285N probably damaging Het
Sema5b T G 16: 35,660,590 F815V probably damaging Het
Serac1 G A 17: 6,048,918 P533S probably damaging Het
Serpina1a C A 12: 103,854,667 probably null Het
Serpinb3b T G 1: 107,157,751 T87P probably damaging Het
Serpinb6d T C 13: 33,671,254 F304L possibly damaging Het
Sertad4 G T 1: 192,847,031 T159N probably damaging Het
Setbp1 G C 18: 78,859,594 P286R probably damaging Het
Sez6 T G 11: 77,973,197 F502V possibly damaging Het
Sez6l T G 5: 112,440,915 Q644P probably damaging Het
Sfmbt2 A C 2: 10,579,183 T784P probably damaging Het
Sgo2b C A 8: 63,927,005 G931V probably damaging Het
Sgo2b T G 8: 63,928,422 T459P possibly damaging Het
Sgtb T C 13: 104,131,939 L118P probably damaging Het
Shank1 C T 7: 44,352,166 A1103V unknown Het
Siglech A G 7: 55,768,994 I182V possibly damaging Het
Sirpa C A 2: 129,618,535 A54D probably damaging Het
Slamf1 T G 1: 171,799,592 V334G probably damaging Het
Slc14a2 T G 18: 78,195,780 K208T probably damaging Het
Slc15a1 C T 14: 121,480,054 R272Q probably benign Het
Slc15a1 A G 14: 121,491,044 L65P probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc1a5 C T 7: 16,797,669 P533L probably damaging Het
Slc22a12 G A 19: 6,538,463 H342Y possibly damaging Het
Slc22a2 G A 17: 12,614,776 E448K probably benign Het
Slc22a28 A C 19: 8,062,398 S537A probably damaging Het
Slc22a3 A T 17: 12,425,681 C472* probably null Het
Slc22a30 C A 19: 8,335,775 V549F probably damaging Het
Slc22a6 A G 19: 8,621,833 D276G probably benign Het
Slc23a1 T C 18: 35,624,508 N237D probably benign Het
Slc25a1 C G 16: 17,927,206 G130A probably benign Het
Slc28a1 C G 7: 81,138,168 P268A probably damaging Het
Slc2a6 G A 2: 27,021,987 P420L probably damaging Het
Slc35a4 A C 18: 36,683,093 *325Y probably null Het
Slc48a1 C A 15: 97,790,681 Y74* probably null Het
Slc4a10 T G 2: 62,228,571 L141V probably damaging Het
Slc4a8 C G 15: 100,761,951 P8A probably benign Het
Slc6a19 C T 13: 73,689,730 E217K possibly damaging Het
Slc6a5 C G 7: 49,911,857 P46A probably benign Het
Slc7a14 G C 3: 31,223,999 L486V probably benign Het
Slco2a1 C A 9: 103,079,527 L513M probably benign Het
Slit2 A G 5: 48,302,353 Y1308C probably damaging Het
Slurp2 C A 15: 74,743,101 V64L probably damaging Het
Smad5 A T 13: 56,728,628 R258S probably benign Het
Smarcc2 G C 10: 128,461,434 G65A probably damaging Het
Smco1 A T 16: 32,273,215 D37V probably damaging Het
Smg1 A C 7: 118,154,635 probably benign Het
Smg1 C A 7: 118,168,661 E1665* probably null Het
Smg1 A G 7: 118,178,399 L1358P possibly damaging Het
Snx15 T C 19: 6,121,411 E211G probably damaging Het
Snx5 C T 2: 144,252,491 R373Q probably benign Het
Sod2 T A 17: 13,013,538 L150H probably damaging Het
Sorcs1 C G 19: 50,222,143 Q761H probably benign Het
Sox12 C G 2: 152,397,465 W78C probably damaging Het
Sox17 G T 1: 4,492,302 S160Y probably damaging Het
Sp9 G C 2: 73,273,230 A43P possibly damaging Het
Spag17 A G 3: 100,095,630 K1890R probably benign Het
Speer4b C G 5: 27,497,941 E188D probably benign Het
Speer4f1 A C 5: 17,479,479 E168D probably damaging Het
Spen C A 4: 141,477,976 E1113D unknown Het
Spen T C 4: 141,477,977 E1113G unknown Het
Sphkap T A 1: 83,276,608 N1140I probably damaging Het
Sphkap T G 1: 83,278,604 T475P probably damaging Het
Spinkl G C 18: 44,174,559 L12V probably damaging Het
Spire1 C A 18: 67,495,152 R509L possibly damaging Het
Spon1 G A 7: 113,766,386 A20T possibly damaging Het
Srd5a3 T C 5: 76,149,821 F33L possibly damaging Het
Srebf2 T G 15: 82,194,921 F783L probably benign Het
Ssbp4 A C 8: 70,599,835 probably benign Het
Ssc5d A C 7: 4,928,434 E213D probably damaging Het
Ssh2 C A 11: 77,449,495 T491N probably damaging Het
Ssrp1 G A 2: 85,040,653 R211H probably damaging Het
Ssxb3 T G X: 8,589,188 S5R probably benign Het
Stam C A 2: 14,139,090 S397* probably null Het
Stambpl1 A T 19: 34,226,627 N39I probably damaging Het
Stap2 G C 17: 55,999,748 A275G probably benign Het
Stard4 G T 18: 33,203,717 Q182K probably benign Het
Stard4 T C 18: 33,203,720 S181G probably benign Het
Stil T G 4: 115,006,693 L44R probably damaging Het
Stk31 G T 6: 49,417,188 probably null Het
Ston2 T G 12: 91,649,067 N189T possibly damaging Het
Stxbp5l T G 16: 37,204,489 Q582H probably benign Het
Sult2a1 T C 7: 13,801,414 Q238R probably benign Het
Sult2a1 A T 7: 13,801,435 F231Y probably benign Het
Sult2a1 T C 7: 13,804,036 I187M probably benign Het
Sult2a6 T C 7: 14,225,894 Q238R probably benign Het
Sycp2 T G 2: 178,374,367 E767D probably benign Het
Sycp2 C T 2: 178,381,934 V430I probably benign Het
Syna C T 5: 134,558,529 R522Q probably benign Het
Syne4 C G 7: 30,316,336 S125C probably damaging Het
Syngap1 A C 17: 26,961,576 D653A probably damaging Het
Synm A C 7: 67,751,886 L285V probably damaging Het
Synpo2l T G 14: 20,665,967 E183D probably damaging Het
Syt10 C T 15: 89,841,639 G44D probably benign Het
Szrd1 C A 4: 141,118,587 R99L probably damaging Het
Taar9 G C 10: 24,108,965 C190W probably damaging Het
Tab2 A T 10: 7,920,266 S77T possibly damaging Het
Taf1a G T 1: 183,404,460 R291M possibly damaging Het
Taf5l C A 8: 123,997,338 G581* probably null Het
Tars G T 15: 11,391,884 P255H probably benign Het
Tas1r2 C T 4: 139,660,424 A398V possibly damaging Het
Tas2r109 T C 6: 132,980,301 Q222R probably benign Het
Tas2r115 G T 6: 132,737,081 C302* probably null Het
Tas2r116 A G 6: 132,855,948 N171D probably benign Het
Tbc1d1 A G 5: 64,275,393 probably null Het
Tbc1d13 T C 2: 30,134,872 probably null Het
Tbc1d4 A C 14: 101,452,423 V1049G probably damaging Het
Tbc1d5 C A 17: 50,963,696 R169I probably damaging Het
Tbxa2r G C 10: 81,333,215 G246A probably damaging Het
Tcaim A C 9: 122,833,657 K430T probably benign Het
Tchh C T 3: 93,445,682 Q810* probably null Het
Tcp10a G C 17: 7,326,449 A58P probably damaging Het
Tctn1 C G 5: 122,251,641 A273P probably damaging Het
Tctn3 A C 19: 40,607,346 F332V possibly damaging Het
Tdrd6 T G 17: 43,626,518 E1213A probably benign Het
Tead4 G C 6: 128,270,904 R57G probably damaging Het
Teddm1a G A 1: 153,892,026 G79R probably benign Het
Tekt5 G A 16: 10,358,377 R435W probably damaging Het
Tenm1 G A X: 42,899,835 P290S probably damaging Het
Tenm2 C T 11: 36,273,267 A384T probably damaging Het
Terf2 A G 8: 107,081,223 L240P probably damaging Het
Tex13c2 A T X: 42,490,562 S211C probably damaging Het
Tex15 A C 8: 33,571,315 K532Q possibly damaging Het
Tex15 A G 8: 33,571,810 I697V possibly damaging Het
Tex15 A G 8: 33,574,870 N1443D probably benign Het
Them6 G A 15: 74,721,569 R92H probably benign Het
Thsd1 G A 8: 22,252,219 R301H probably damaging Het
Thumpd3 C G 6: 113,056,030 T243S probably benign Het
Tiam2 C T 17: 3,415,019 S341F probably benign Het
Tie1 A G 4: 118,484,429 C229R probably damaging Het
Timm44 C T 8: 4,268,004 E135K probably benign Het
Tlr11 T G 14: 50,362,338 F594V possibly damaging Het
Tlr4 G A 4: 66,929,082 D149N probably benign Het
Tm9sf3 A G 19: 41,232,378 Y382H probably damaging Het
Tmc3 A C 7: 83,603,468 K359T probably damaging Het
Tmem132a G A 19: 10,858,935 R744C probably damaging Het
Tmem132c G A 5: 127,504,921 S400N probably benign Het
Tmem189 G C 2: 167,644,864 Y198* probably null Het
Tmem198 C A 1: 75,480,262 Q11K probably benign Het
Tmem219 G C 7: 126,891,674 P198A possibly damaging Het
Tmem246 A G 4: 49,587,135 L11P probably damaging Het
Tmem270 A C 5: 134,906,656 L15R probably damaging Het
Tmem39a C A 16: 38,575,778 F124L possibly damaging Het
Tmem39b C G 4: 129,692,477 A4P probably benign Het
Tmem45b A G 9: 31,428,027 F131L probably damaging Het
Tmppe G A 9: 114,405,077 R148H probably benign Het
Tmprss4 T A 9: 45,175,465 N333Y probably damaging Het
Tnni3k G C 3: 154,939,670 A526G probably damaging Het
Tnpo1 C G 13: 98,860,670 G417A probably benign Het
Tnpo3 C G 6: 29,565,843 G504A probably benign Het
Tnr T C 1: 159,895,095 F1037L probably benign Het
Tnrc6b C T 15: 80,927,690 R813* probably null Het
Togaram2 A G 17: 71,714,280 K687R possibly damaging Het
Tox C A 4: 6,688,450 R519M probably damaging Het
Tpo T C 12: 30,094,782 D656G probably damaging Het
Trank1 G A 9: 111,364,710 D601N probably damaging Het
Trav13d-4 C G 14: 53,073,170 T76S probably benign Het
Trav16n C T 14: 53,351,573 A101V possibly damaging Het
Trav5-4 A G 14: 53,704,239 E23G possibly damaging Het
Trav8d-2 T G 14: 53,042,808 L85R probably damaging Het
Tril G A 6: 53,818,920 T439M probably benign Het
Trim30a C A 7: 104,435,654 W116C probably damaging Het
Trim30b C A 7: 104,366,100 S27I probably damaging Het
Trim42 T G 9: 97,369,622 N75H probably benign Het
Trim43c A C 9: 88,842,935 probably null Het
Trim45 A C 3: 100,925,640 E396D probably benign Het
Trim5 C T 7: 104,266,225 A294T possibly damaging Het
Trim67 A G 8: 124,817,041 Q380R probably damaging Het
Triml1 T A 8: 43,130,398 I389F probably damaging Het
Trip12 A C 1: 84,766,168 N500K probably damaging Het
Trip4 G A 9: 65,864,415 R278* probably null Het
Trp53bp1 T C 2: 121,253,645 K247E probably benign Het
Trp63 G A 16: 25,763,313 R37K probably benign Het
Trpm7 G T 2: 126,797,281 A1711E probably damaging Het
Trrap A G 5: 144,834,197 K2802R probably benign Het
Tspan5 G C 3: 138,898,326 W228C possibly damaging Het
Tssk4 A G 14: 55,650,923 K83R probably damaging Het
Ttbk1 C A 17: 46,446,325 A1128S probably benign Het
Ttc16 C A 2: 32,769,333 L251F probably damaging Het
Ttc23l C A 15: 10,533,667 R263S probably damaging Het
Ttc28 G C 5: 111,286,315 G2405A probably benign Het
Ttc30b T G 2: 75,937,982 E142D probably benign Het
Ttc39c G T 18: 12,686,963 M15I possibly damaging Het
Ttll1 C T 15: 83,498,189 V201I probably damaging Het
Ttll12 T C 15: 83,582,078 Q394R probably damaging Het
Ttll2 T G 17: 7,351,526 D334A probably damaging Het
Ttn T G 2: 76,738,687 E25541D possibly damaging Het
Ttn C G 2: 76,746,951 E24533Q probably damaging Het
Ttn G T 2: 76,752,230 A14446E probably damaging Het
Ttn A G 2: 76,752,519 W20931R probably damaging Het
Ttn T G 2: 76,787,269 K14540T probably damaging Het
Ttn T G 2: 76,848,325 probably benign Het
Tubal3 A C 13: 3,933,511 E430D probably benign Het
Tubb3 G C 8: 123,421,534 G402A probably damaging Het
Tubd1 A T 11: 86,555,167 K211M probably damaging Het
Tubd1 G A 11: 86,549,470 G107S probably damaging Het
Tubgcp5 G A 7: 55,815,101 G577S probably benign Het
Tulp2 A C 7: 45,521,986 K404T probably damaging Het
Tyro3 T G 2: 119,809,467 I377S probably benign Het
Ube4b A G 4: 149,335,125 I1042T possibly damaging Het
Ubl4b T G 3: 107,554,403 E180D unknown Het
Ubqln5 T A 7: 104,128,971 K215N possibly damaging Het
Ubqlnl A G 7: 104,149,993 V99A probably damaging Het
Ubr3 A G 2: 69,922,367 T322A probably benign Het
Uggt1 A C 1: 36,174,191 F861C probably damaging Het
Ugt1a10 T C 1: 88,055,842 F121L probably benign Het
Umps CCTGACTGA CCTGA 16: 33,966,825 probably null Het
Unc13a C A 8: 71,654,803 probably null Het
Unc5c T G 3: 141,733,900 L111V probably damaging Het
Unc79 C A 12: 103,021,012 H187N probably damaging Het
Unc80 C G 1: 66,646,451 P2245A possibly damaging Het
Ush2a T C 1: 188,911,983 L4514P probably benign Het
Ush2a A C 1: 188,947,004 N4803T probably benign Het
Usp17lb G A 7: 104,841,129 P197L probably benign Het
Usp43 C A 11: 67,856,040 R942L probably benign Het
Usp51 C T X: 153,008,222 P271S probably benign Het
Usp51 C T X: 153,008,223 P271L probably benign Het
Vmn1r12 T G 6: 57,158,981 L21R probably damaging Het
Vmn1r176 C T 7: 23,835,173 R185H probably benign Het
Vmn1r179 A G 7: 23,928,482 I33V probably benign Het
Vmn1r188 T C 13: 22,088,280 W135R probably damaging Het
Vmn1r212 A C 13: 22,883,762 F134V probably damaging Het
Vmn1r229 C A 17: 20,815,065 L191M probably damaging Het
Vmn1r232 C A 17: 20,913,838 V167F probably benign Het
Vmn1r4 G A 6: 56,957,065 V185M possibly damaging Het
Vmn1r46 A G 6: 89,976,741 R191G probably damaging Het
Vmn1r72 T G 7: 11,670,173 N116T probably benign Het
Vmn1r78 A C 7: 12,152,714 K84T probably damaging Het
Vmn2r10 A G 5: 108,996,113 F657S probably damaging Het
Vmn2r101 C A 17: 19,588,975 A122D possibly damaging Het
Vmn2r103 C A 17: 19,795,047 S483Y probably benign Het
Vmn2r108 C T 17: 20,471,113 V383M probably benign Het
Vmn2r110 T G 17: 20,583,680 H211P probably damaging Het
Vmn2r112 C G 17: 22,605,078 S438C possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r12 G T 5: 109,092,780 H156N probably benign Het
Vmn2r16 A C 5: 109,340,515 Q418P probably benign Het
Vmn2r16 TA T 5: 109,363,913 probably null Het
Vmn2r19 T G 6: 123,308,339 L3V probably benign Het
Vmn2r23 A C 6: 123,742,108 T807P probably damaging Het
Vmn2r24 A C 6: 123,804,196 S454R probably benign Het
Vmn2r45 T A 7: 8,471,485 E848V probably benign Het
Vmn2r5 T G 3: 64,509,542 N65T probably benign Het
Vmn2r50 G C 7: 10,037,500 T758R possibly damaging Het
Vmn2r50 G T 7: 10,046,159 L432I probably benign Het
Vmn2r59 G T 7: 42,012,414 A659E possibly damaging Het
Vmn2r61 A G 7: 42,299,964 T603A possibly damaging Het
Vmn2r63 G A 7: 42,928,559 T185I probably benign Het
Vmn2r65 C A 7: 84,943,265 probably null Het
Vmn2r70 A C 7: 85,564,760 L395V possibly damaging Het
Vmn2r79 T G 7: 87,002,341 F316C probably damaging Het
Vmn2r8 A C 5: 108,801,998 F328V probably damaging Het
Vmn2r82 T G 10: 79,356,622 F11C probably damaging Het
Vmn2r87 C A 10: 130,472,314 R685M probably damaging Het
Vmn2r90 C A 17: 17,733,617 A681E probably damaging Het
Vmn2r93 A C 17: 18,326,403 K846Q probably damaging Het
Vmn2r95 C A 17: 18,440,401 F358L probably benign Het
Vmn2r96 T A 17: 18,597,366 L594I possibly damaging Het
Vmn2r99 C A 17: 19,379,301 Q416K probably benign Het
Vmo1 T A 11: 70,513,817 L119F probably damaging Het
Vps13c T C 9: 67,913,975 S1256P probably damaging Het
Vwa8 C T 14: 78,982,246 A478V probably benign Het
Washc4 C G 10: 83,576,741 A749G probably benign Het
Wbp2 T A 11: 116,086,913 K5* probably null Het
Wdcp A C 12: 4,850,825 K227T probably damaging Het
Wdr13 A C X: 8,125,622 F369V probably damaging Het
Wdr13 C A X: 8,125,624 S460I probably damaging Het
Wdr3 T G 3: 100,144,344 K663T probably benign Het
Wdr36 T G 18: 32,866,012 probably null Het
Wdr53 T A 16: 32,252,298 S154T probably damaging Het
Wdr5b G A 16: 36,042,443 A311T probably damaging Het
Wdr64 A T 1: 175,705,985 Q62H possibly damaging Het
Wdr82 A C 9: 106,184,800 I221L probably benign Het
Wnt5a C T 14: 28,522,728 R311C probably damaging Het
Wrap53 G A 11: 69,578,498 S144F probably damaging Het
Wsb2 C A 5: 117,377,506 P392Q probably damaging Het
Wwc1 T G 11: 35,883,482 N317T possibly damaging Het
Wwp2 G A 8: 107,555,087 E303K probably damaging Het
Xdh C T 17: 73,886,428 S1291N probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Xirp2 A G 2: 67,513,321 T1969A probably benign Het
Xpot A C 10: 121,601,323 I830S probably damaging Het
Xylb T A 9: 119,381,614 L388M probably benign Het
Ylpm1 G A 12: 85,030,155 R760K possibly damaging Het
Zadh2 G A 18: 84,094,927 V243I probably damaging Het
Zbtb34 C G 2: 33,411,108 E474Q probably damaging Het
Zc3h12b A C X: 95,899,442 K116T probably damaging Het
Zdhhc17 T C 10: 110,945,466 probably null Het
Zfat G A 15: 68,187,101 A195V probably benign Het
Zfhx2 T G 14: 55,074,180 Q352H possibly damaging Het
Zfhx3 A C 8: 108,951,357 K3013T possibly damaging Het
Zfp106 G T 2: 120,530,490 L1047I probably damaging Het
Zfp109 A G 7: 24,228,935 F358L probably benign Het
Zfp157 T C 5: 138,457,199 L553P probably damaging Het
Zfp273 A T 13: 67,825,394 I214F possibly damaging Het
Zfp326 T A 5: 105,888,630 Y136N probably damaging Het
Zfp386 G A 12: 116,054,773 E21K possibly damaging Het
Zfp42 C G 8: 43,295,805 V220L probably benign Het
Zfp507 C G 7: 35,794,277 S447T possibly damaging Het
Zfp518b C A 5: 38,674,293 S123I probably damaging Het
Zfp541 A C 7: 16,079,795 K791T probably benign Het
Zfp553 G T 7: 127,235,498 G75V probably damaging Het
Zfp57 T C 17: 37,010,138 F295L probably damaging Het
Zfp593 G C 4: 134,245,442 A21G probably benign Het
Zfp598 CCAT CCATCAT 17: 24,680,210 probably benign Het
Zfp638 A C 6: 83,944,811 K640T probably damaging Het
Zfp648 T C 1: 154,204,520 F142L probably benign Het
Zfp729b C T 13: 67,593,070 E359K possibly damaging Het
Zfp775 G A 6: 48,620,688 E499K probably damaging Het
Zfp868 TTAT TT 8: 69,611,910 probably null Het
Zfp959 A G 17: 55,898,135 R391G probably damaging Het
Zfp976 T G 7: 42,612,760 E551A possibly damaging Het
Zfx A C X: 94,079,443 L585V probably damaging Het
Zglp1 C T 9: 21,067,000 R27Q possibly damaging Het
Zhx3 GGAAG GG 2: 160,779,755 probably benign Het
Zic2 A T 14: 122,478,675 H403L probably damaging Het
Zim1 T G 7: 6,677,659 N335T possibly damaging Het
Zkscan3 T C 13: 21,388,565 K299R possibly damaging Het
Zkscan4 T G 13: 21,483,897 L173V probably damaging Het
Zmiz2 A T 11: 6,399,603 H421L probably damaging Het
Zmynd15 A C 11: 70,461,135 K60T possibly damaging Het
Zmynd8 A C 2: 165,828,171 L481R probably benign Het
Zpbp C A 11: 11,408,568 R233L probably damaging Het
Zscan18 G T 7: 12,775,067 Q169K probably benign Het
Zscan18 G A 7: 12,775,093 probably benign Het
Zscan26 T G 13: 21,445,463 K290T probably damaging Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8121:Serpinb6c UTSW 13 33880218 missense probably benign 0.38
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8745:Serpinb6c UTSW 13 33880719 missense probably benign 0.06
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers
Posted On2017-02-27