Incidental Mutation 'R0562:Car5a'
ID45954
Institutional Source Beutler Lab
Gene Symbol Car5a
Ensembl Gene ENSMUSG00000025317
Gene Namecarbonic anhydrase 5a, mitochondrial
SynonymsCar5
MMRRC Submission 038753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0562 (G1)
Quality Score214
Status Validated
Chromosome8
Chromosomal Location121916126-121944904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121944730 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 22 (T22S)
Ref Sequence ENSEMBL: ENSMUSP00000060457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057653] [ENSMUST00000127664]
PDB Structure
MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AT 2.45 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
COMPLEX BETWEEN MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AND THE TRANSITION STATE ANALOGUE ACETAZOLAMIDE [X-RAY DIFFRACTION]
Crystal Structure of F65A/Y131C Carbonic Anhydrase V, covalently modified with 4-chloromethylimidazole [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE V [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057653
AA Change: T22S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000060457
Gene: ENSMUSG00000025317
AA Change: T22S

DomainStartEndE-ValueType
Carb_anhydrase 27 290 6.61e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195830
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, hyperammonemia, and increased levels of urinary metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,977,113 M120V probably benign Het
9530053A07Rik G A 7: 28,162,690 V2394I probably benign Het
Acadsb C T 7: 131,425,789 Q63* probably null Het
Adam26b A T 8: 43,520,371 N531K probably benign Het
Agt A G 8: 124,559,275 I356T probably benign Het
Ankmy1 A T 1: 92,899,691 probably benign Het
Anxa3 C T 5: 96,812,884 S49L possibly damaging Het
Arap3 C A 18: 37,975,540 R1279L probably damaging Het
Azin1 A G 15: 38,493,581 I266T probably benign Het
Btnl7-ps T C 17: 34,533,524 noncoding transcript Het
Card6 A G 15: 5,105,166 I185T probably damaging Het
Ccdc81 T C 7: 89,903,229 D11G probably benign Het
Cep170b T C 12: 112,739,189 V1127A probably benign Het
Ces1h T C 8: 93,357,143 I390M unknown Het
Col9a1 T A 1: 24,179,279 probably null Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Cyb561a3 T C 19: 10,586,710 V138A probably benign Het
Dcaf1 T C 9: 106,844,122 probably benign Het
Dnah17 A G 11: 118,072,900 Y2516H probably damaging Het
Dsc2 T A 18: 20,041,537 N521Y probably damaging Het
Dst G A 1: 34,227,981 E4835K probably damaging Het
Duox2 T C 2: 122,289,599 E810G probably damaging Het
Dusp15 T C 2: 152,951,348 N3S possibly damaging Het
Epha4 T C 1: 77,388,487 K625R probably benign Het
Gata5 C T 2: 180,327,759 probably null Het
Gm10264 A G 12: 88,329,666 D138G unknown Het
Gm14139 T A 2: 150,192,574 C303S probably damaging Het
Grm5 A G 7: 87,603,019 N159S probably damaging Het
Hivep3 T A 4: 120,096,554 M689K probably benign Het
Ilvbl G T 10: 78,583,487 G499C probably damaging Het
Inpp4b T C 8: 81,768,151 I65T possibly damaging Het
Jarid2 T C 13: 44,902,359 V208A probably damaging Het
Kcnh4 T C 11: 100,750,244 M460V possibly damaging Het
Klhl22 A G 16: 17,792,624 N580D probably benign Het
Klk15 T A 7: 43,938,845 C192* probably null Het
Klk9 A G 7: 43,795,666 E194G probably damaging Het
Lama1 G T 17: 67,815,959 G2779V probably damaging Het
Lmln C T 16: 33,117,085 R607* probably null Het
Maea T C 5: 33,372,301 V377A probably benign Het
Matk A T 10: 81,259,691 Y115F probably benign Het
Mettl18 A G 1: 163,996,493 K128E probably benign Het
Mrps22 T C 9: 98,592,693 H246R probably benign Het
Msln A T 17: 25,753,006 M79K probably benign Het
Myf6 G A 10: 107,494,559 P49L probably benign Het
Nat1 C T 8: 67,491,311 T113I possibly damaging Het
Ncor2 C T 5: 125,085,029 V394M unknown Het
Oas1c T C 5: 120,805,604 probably benign Het
Olfr1053 T A 2: 86,314,525 T254S probably benign Het
Otp A T 13: 94,877,409 T112S probably damaging Het
Pcdh7 A G 5: 57,720,063 N320S probably damaging Het
Pdzd2 G T 15: 12,592,278 F93L probably damaging Het
Phf20l1 A G 15: 66,609,604 E283G probably damaging Het
Polr1e T C 4: 45,029,421 F342S probably damaging Het
Pp2d1 T A 17: 53,539,168 probably benign Het
Ptpn13 T A 5: 103,516,425 probably null Het
Reg3g A T 6: 78,467,488 H107Q possibly damaging Het
Rgl1 T C 1: 152,539,945 K408E probably damaging Het
Samd4 T C 14: 47,077,509 C309R probably damaging Het
Sestd1 C A 2: 77,230,722 W104L probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc22a21 T A 11: 53,979,620 K80* probably null Het
Snx20 T A 8: 88,630,002 Q62L probably benign Het
Stk40 C A 4: 126,138,801 probably benign Het
Taf2 A T 15: 55,022,188 probably benign Het
Tcf23 C T 5: 30,970,310 P152L probably damaging Het
Tex29 T C 8: 11,844,138 probably benign Het
Tjp3 A G 10: 81,280,555 V235A probably damaging Het
Tns3 A T 11: 8,493,262 I367N possibly damaging Het
Ttc26 T A 6: 38,401,129 V292E probably damaging Het
Ttn T A 2: 76,712,911 M33244L probably benign Het
Ush2a A T 1: 188,356,847 N333I probably damaging Het
Usp34 T C 11: 23,432,406 probably benign Het
Vmn1r204 A C 13: 22,556,678 S160R probably benign Het
Vmn2r75 C T 7: 86,148,241 W788* probably null Het
Vwa5b1 T C 4: 138,635,711 probably benign Het
Zbtb7a A G 10: 81,148,329 E535G probably benign Het
Zranb3 T C 1: 128,036,558 D144G probably benign Het
Other mutations in Car5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Car5a APN 8 121923610 missense probably benign 0.07
IGL01972:Car5a APN 8 121927082 critical splice donor site probably null
R0152:Car5a UTSW 8 121916446 missense probably damaging 1.00
R0699:Car5a UTSW 8 121944816 unclassified probably benign
R1827:Car5a UTSW 8 121923808 missense probably benign 0.00
R2274:Car5a UTSW 8 121944669 critical splice donor site probably null
R4261:Car5a UTSW 8 121944749 missense probably benign 0.03
R5436:Car5a UTSW 8 121917242 intron probably benign
R5869:Car5a UTSW 8 121916380 missense probably benign
R5937:Car5a UTSW 8 121939821 missense probably damaging 1.00
R6388:Car5a UTSW 8 121927171 missense probably damaging 1.00
R6803:Car5a UTSW 8 121923765 critical splice donor site probably null
R7369:Car5a UTSW 8 121923834 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGGAAGCCAACCATGTTGCCTC -3'
(R):5'- TTACCAGGCCAAAGCAGTGACCAG -3'

Sequencing Primer
(F):5'- GCCAACCATGTTGCCTCTTAAAG -3'
(R):5'- CCACTAGGTTCAGAGGTTTTAATGAG -3'
Posted On2013-06-11